ORFeome > tmem117 ORF1 – XORFeome v1.0

tmem117 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem117
Gene ID: 982358
Gene Page ID: 982354
ORF Xenbase ID: 17301171

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126025
Original XGC clone length: 1515

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ837513
dbEST ID: 79655215
Trimmed Sequence: ATGGATAAAGACTTCCGTTACTATTTCCAGCACCCGTGGTCCCGCATTATAATCGCTTACCTTGTGACCTTCCTTAACTTTTTAATGTTTGCGGAGGATCCTATATCTCACAGCCAAACTGAGGCTAATGTGATTGTTGTTGGAAATTGTTTTTCTTTTATGATTACGAAATACCCTGGAGTAGGCTGGGGTGTTTTGAAGGTGATACTCTGGCTGCTAGCCATTGTCACTGGGCTTTTCGCTGGAAAGTTCCTGTTTCATCAGCGATTGTTTGGTCATGTGCTTCGATTAAAAATGTTTAGGGAAGACCATGGATCATGGATGACCATGTTTTTCAGCACTATCCTTTTTCTCTTCTTTTTTTCACATATCTACAATCTGTTTCTTCTTATGGCAGGAGGCATGAGCATATACATTATAAATGAATATATGGATATCAGAAACGAAAGCTTCATGAAAGTAGCAGCAGTGGGAACTTGGATGGGAGACTTTGTAACTGCATGGATGGTCACTGATATGATGCTTCAGGACAACCAATACCCAGAGTGGGGCAAGCCAGCAAGATGTTTTTGGCGAAGAGGAAATACACGAATAATCTTGTTCTGGACTGTTCTGTTTAGCCTTACCTCTGTTGTTGTTTTGGTTATTACCACTGACTGGATAAGCTGGGACAAGCTGAAATTGGGGATTTTTGCCAAGTGATGAGGTCTCCCGGGGCTTTCTAGCTTCATTTTATCTTGGTGTTTGACCTTCTTGATGGTATGCAAGGAACGGGGAGTTCCAACTTTTTAGGGGG
Full Trace Sequence: CGGGGGCCCAAATAATTGATTTTATTTCTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATAAAGACTTCCGTTACTATTTCCAGCACCCGTGGTCCCGCATTATAATCGCTTACCTTGTGACCTTCCTTAACTTTTTAATGTTTGCGGAGGATCCTATATCTCACAGCCAAACTGAGGCTAATGTGATTGTTGTTGGAAATTGTTTTTCTTTTATGATTACGAAATACCCTGGAGTAGGCTGGGGTGTTTTGAAGGTGATACTCTGGCTGCTAGCCATTGTCACTGGGCTTTTCGCTGGAAAGTTCCTGTTTCATCAGCGATTGTTTGGTCATGTGCTTCGATTAAAAATGTTTAGGGAAGACCATGGATCATGGATGACCATGTTTTTCAGCACTATCCTTTTTCTCTTCTTTTTTTCACATATCTACAATCTGTTTCTTCTTATGGCAGGAGGCATGAGCATATACATTATAAATGAATATATGGATATCAGAAACGAAAGCTTCATGAAAGTAGCAGCAGTGGGAACTTGGATGGGAGACTTTGTAACTGCATGGATGGTCACTGATATGATGCTTCAGGACAACCAATACCCAGAGTGGGGCAAGCCAGCAAGATGTTTTTGGCGAAGAGGAAATACACGAATAATCTTGTTCTGGACTGTTCTGTTTAGCCTTACCTCTGTTGTTGTTTTGGTTATTACCACTGACTGGATAAGCTGGGACAAGCTGAAATTGGGGATTTTTGCCAAGTGATGAGGTCTCCCGGGGCTTTCTAGCTTCATTTTATCTTGGTGTTTGACCTTCTTGATGGTATGCAAGGAACGGGGAGTTCCAACTTTTTAGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATAAAGACTTCCGTTACTAT

Sequences - 3ʹ (reverse) EST

Accession: JZ837512
dbEST ID: 79655214
Trimmed Sequence: GCTTTCAGAGTCTTCAGTGCAGATACAATGTTCTGAAGATCTCAGTGTCTCAGAGGTCAGTGAAGGAGAAGGACAATTTGAGATTTCACTGGATTTTGTCCTGATTGAAATTAAAGTTGGATCGTGTAGGTATAAAGGTTCCTCCACGACCGCCTGCAGATTCTCAATAGTCATTCCCATTTCTTTGCTGTGCTCAGAGGGGGATTTCCTATTGATACGTGTGTATGTTTTGTCTTTATTTTCCATCCCTTGTTCACTTTTTTTAAACCGACCGAAGAATGATATGAAAAATCCAAATAAGACAAAAGCCATAAGACTTGGAATAAAGGCCAGACATTTAACATTCAGACTTGACCCAATAAACCTACTGCGCAAGAACATATCCCCCTCTACGTAGGACCTGTTTGTGTATGGGTCTGTGTTATTTGATCGCCATTCATACGTTAACGTTGTCTTGTTGAGGTTTTGTAAACTTTCAGCGTCTTCAACAGTATATATCTTCTGTCCTGGACCTATATACTGGCCATAAGCGGATGGCTGGTAAAATATTTGGTTTTTCCACATATTAAGATCAAGGATGAGCACGAGAAATATTATGCCATAGTTAAACCATTTACCTGTGATACGTATATGATATTCTTCTTTAAAAATCCCGATGGAGGTATGGAACTCTGGAATTGTAAGTGAGCAGTAGACCATCCTGGGAAGGTTAACATCAACATCCCCCCCATAAATGGTGGAAAATTCCCCAAGTCCTTGCATAAACCATC
Full Trace Sequence: CGGGAAGCAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTTTCAGAGTCTTCAGTGCAGATACAATGTTCTGAAGATCTCAGTGTCTCAGAGGTCAGTGAAGGAGAAGGACAATTTGAGATTTCACTGGATTTTGTCCTGATTGAAATTAAAGTTGGATCGTGTAGGTATAAAGGTTCCTCCACGACCGCCTGCAGATTCTCAATAGTCATTCCCATTTCTTTGCTGTGCTCAGAGGGGGATTTCCTATTGATACGTGTGTATGTTTTGTCTTTATTTTCCATCCCTTGTTCACTTTTTTTAAACCGACCGAAGAATGATATGAAAAATCCAAATAAGACAAAAGCCATAAGACTTGGAATAAAGGCCAGACATTTAACATTCAGACTTGACCCAATAAACCTACTGCGCAAGAACATATCCCCCTCTACGTAGGACCTGTTTGTGTATGGGTCTGTGTTATTTGATCGCCATTCATACGTTAACGTTGTCTTGTTGAGGTTTTGTAAACTTTCAGCGTCTTCAACAGTATATATCTTCTGTCCTGGACCTATATACTGGCCATAAGCGGATGGCTGGTAAAATATTTGGTTTTTCCACATATTAAGATCAAGGATGAGCACGAGAAATATTATGCCATAGTTAAACCATTTACCTGTGATACGTATATGATATTCTTCTTTAAAAATCCCGATGGAGGTATGGAACTCTGGAATTGTAAGTGAGCAGTAGACCATCCTGGGAAGGTTAACATCAACATCCCCCCCATAAATGGTGGAAAATTCCCCAAGTCCTTGCATAAACCATC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTTTCAGAGTCTTCAGTG