ORFeome > tmem120a ORF1 – XORFeome v1.0

tmem120a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem120a
Gene ID: 5858597
Gene Page ID: 5858564
ORF Xenbase ID: 17301177

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129679
Original XGC clone length: 1011

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ838676
dbEST ID: 79656378
Trimmed Sequence: ATGAATTCTCCGGTGCTGCAGGACTGTGTGCGGGAGTGGGGGGAGATTCAAGAGAACTACCAGGACATACAGGAAACACATCGATTATACAAGCAGAAGCTAGAGGAACTATCAAAGCTACAGACGCGCTGCTCAGGTACCATTTCTCGTCAGAAAAAGAAGCTTCGAGAATTATCTGTGGAATTAAAGAAATGTAAATCCAAGGCAAAAAATGTGGAAGAAGAAGAAGAACAAATTAGAGACTTGAATAATCAAATCAGAGCACGGGAAAAAACATTCTTTGAGATGGAGTCTTTTCTGCCAAAGAAAAACGGATTGTACCTCAGTCTAGTACTGGGAAACGTGAATGTGACTCTCCTAAGCAAACAGGCAAAGTTTGCATACAAAGATGAGTATGAGAAGTTCAAGCTGTACCTTACCATAATCCTTATGGTACTCTCCTTCATATGTCGCTTTCTCTTAAACTCCAGGGTTACAGATGCAGTGTTTAACTTCCCACTAGTGTGGTATTACTGCACGTTGACTATACGTGAAAGTATTTTAATCAACAACGAATCCGGAATTAAAGGCCTGTGGGTTCTAAACCCTTAAATTTTCCACATACTAGTTGGGAGCCGGGTGACATGACCTGATGGTTTAATGGACCAGAGGTTCAAGAAATCAATTTTTTTTCTTTTCCATTTAACAAAGTGATTTTTCGGTTTTCGCAATATAAAGAGCAAAAATGGATAGCCTACAAAGAAGTATCAAGCTCTAAGGAAAAAGGGGAAAAAGGGAACATGGAAACTTTA
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATTCTCCGGTGCTGCAGGACTGTGTGCGGGAGTGGGGGGAGATTCAAGAGAACTACCAGGACATACAGGAAACACATCGATTATACAAGCAGAAGCTAGAGGAACTATCAAAGCTACAGACGCGCTGCTCAGGTACCATTTCTCGTCAGAAAAAGAAGCTTCGAGAATTATCTGTGGAATTAAAGAAATGTAAATCCAAGGCAAAAAATGTGGAAGAAGAAGAAGAACAAATTAGAGACTTGAATAATCAAATCAGAGCACGGGAAAAAACATTCTTTGAGATGGAGTCTTTTCTGCCAAAGAAAAACGGATTGTACCTCAGTCTAGTACTGGGAAACGTGAATGTGACTCTCCTAAGCAAACAGGCAAAGTTTGCATACAAAGATGAGTATGAGAAGTTCAAGCTGTACCTTACCATAATCCTTATGGTACTCTCCTTCATATGTCGCTTTCTCTTAAACTCCAGGGTTACAGATGCAGTGTTTAACTTCCCACTAGTGTGGTATTACTGCACGTTGACTATACGTGAAAGTATTTTAATCAACAACGAATCCGGAATTAAAGGCCTGTGGGTTCTAAACCCTTAAATTTTCCACATACTAGTTGGGAGCCGGGTGACATGACCTGATGGTTTAATGGACCAGAGGTTCAAGAAATCAATTTTTTTTCTTTTCCATTTAACAAAGTGATTTTTCGGTTTTCGCAATATAAAGAGCAAAAATGGATAGCCTACAAAGAAGTATCAAGCTCTAAGGAAAAAGGGGAAAAAGGGAACATGGAAACTTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATTCTCCGGTGCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838675
dbEST ID: 79656377
Trimmed Sequence: ATTTTGCTTTTGGAATTTTTGGTGGACGACTCGGAGTGTTGTGAAAAAATTCCCCAAGAAGTGGACAAGGAAGGGGAGGCCGCACATTATCACCTGCCATTCCTTGCACTCTGGGTGTCTAGCCAGTTTGAAGAGGGTGATAGCATTATAAAGTTGCCAAAACTGACCAAAGAAGAGAAACGGCAGGAGGAAGGTCAGACCTCTCCACATCCAGGACTGAAAACCCTCAACTGTCAGGTCCATGTTATGCCTCTCCCCTAGAGCTCGAAGTCTATAGAGACAGCCACTTTGATAGTAATATTGCAGAAACTGAACAAAACTTTGGTACATGGAAAAAGACAAAAATTGATTCCTGAACATCTGGTACATTAAACCATCAGGCCATGTCAGCATGACTCCAGACAGAAATGTGGAAATATAATGGTTTAGAACCCACCAGCCTTTAATTCTGGATCCGTTGTTGATTAGAATACTTTCACGGATAGTCAACGTGCAGTAATACCACACTAGTAGGAAGTTAAACACTGCATCTGTAACCCTGGAGTTTAAAAAAAAGCAACATATGAAGGAGAGTACCATAAAGGATTAAGGTAAGGGTACGGCCTGGAACTTCTCATACTCCTCTTTTGTATGCAAACCTTTGCCTGTTTTGCCTAGGGAGAGTCACATTTCACGTTTTCCCCTTATCTAAACCGAAGGTAACGTTCCCGGTTTTTCCCTTTTGCCAAAAAAAAACTCCGGTCCAAAAAAAAAAGGAATTTTTTTCCCCCGGG
Full Trace Sequence: GGCAAACGGCTAGTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTTTGCTTTTGGAATTTTTGGTGGACGACTCGGAGTGTTGTGAAAAAATTCCCCAAGAAGTGGACAAGGAAGGGGAGGCCGCACATTATCACCTGCCATTCCTTGCACTCTGGGTGTCTAGCCAGTTTGAAGAGGGTGATAGCATTATAAAGTTGCCAAAACTGACCAAAGAAGAGAAACGGCAGGAGGAAGGTCAGACCTCTCCACATCCAGGACTGAAAACCCTCAACTGTCAGGTCCATGTTATGCCTCTCCCCTAGAGCTCGAAGTCTATAGAGACAGCCACTTTGATAGTAATATTGCAGAAACTGAACAAAACTTTGGTACATGGAAAAAGACAAAAATTGATTCCTGAACATCTGGTACATTAAACCATCAGGCCATGTCAGCATGACTCCAGACAGAAATGTGGAAATATAATGGTTTAGAACCCACCAGCCTTTAATTCTGGATCCGTTGTTGATTAGAATACTTTCACGGATAGTCAACGTGCAGTAATACCACACTAGTAGGAAGTTAAACACTGCATCTGTAACCCTGGAGTTTAAAAAAAAGCAACATATGAAGGAGAGTACCATAAAGGATTAAGGTAAGGGTACGGCCTGGAACTTCTCATACTCCTCTTTTGTATGCAAACCTTTGCCTGTTTTGCCTAGGGAGAGTCACATTTCACGTTTTCCCCTTATCTAAACCGAAGGTAACGTTCCCGGTTTTTCCCTTTTGCCAAAAAAAAACTCCGGTCCAAAAAAAAAAGGAATTTTTTTCCCCCGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTTTGCTTTTGGAATTTTTGGT