ORFeome > tmem144 ORF1 – XORFeome v1.0

tmem144 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem144
Gene ID: 966062
Gene Page ID: 966056
ORF Xenbase ID: 17301207

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC153767
Original XGC clone length: 1071

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ839048
dbEST ID: 79656750
Trimmed Sequence: ATGGCAAACCTAATTACAGCTGCAAATAGTACCAACACTGAGCTTACAATCGGCTTCATCTCCTCTGCTGTATCGGTTCTCTTGTATGGCTCAAACTTTGTTCCAGTAAAGAAGTTTGATACTGGAGATGGCATGTTTTTCCAGTGGATACTCTGTGCTTCCATATGGATTGTCTCTTTGGTGGTCAATATTATTCTTCATTCCCCAAAATTCTGGCCTCTAGCTATGGTAGGAGGCTGTGTCTGGGCTACAGGGAACATAACAGTTGTTCCAATTGTTAAAACAGTTGGTCTTGGACTGGGTCTGTTAATTTGGGCTTCATTTAATCTTCTAACTGGCTGGGCGAGTTCAAGGTTTGGCATGTTTGGAATAGACCCAGAAATTGTTGCTAACCCAAACTTAAATTATGCTGGAGCTGGTCTTTCAGCATTAAGTGCCGTCATTTTTTTGTTTGTGAAATCCGACGTAAACAGTGCCACATCAGTTTCAGAATCGGATATCACCCCGCTACTTAGCAATAGTCTTAATTCCCAGCAAAACATTGTTTCAGATGAATCATGGGTAGACAAGCTATCACCGCTGCAAAAACGATTGATAGGGTCTGCGATGGCAGTTGTAGCAGGAATTCTCTATGGCTCCAACTTTATCCCAGTTCTCTACATCAAGGACCACAGCAAAAATAATCCAAACAAAATGCTGGGTGCAACCCAGTTGAATTAGATTACGTCTTTGCACACTTTCTTGGAATTTTTCCTAAAAGATACATTCCATTTTTCTAAATATACTGGGCATAAATGAAAAATTCCCCCCAAAAT
Full Trace Sequence: TCGAGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAAACCTAATTACAGCTGCAAATAGTACCAACACTGAGCTTACAATCGGCTTCATCTCCTCTGCTGTATCGGTTCTCTTGTATGGCTCAAACTTTGTTCCAGTAAAGAAGTTTGATACTGGAGATGGCATGTTTTTCCAGTGGATACTCTGTGCTTCCATATGGATTGTCTCTTTGGTGGTCAATATTATTCTTCATTCCCCAAAATTCTGGCCTCTAGCTATGGTAGGAGGCTGTGTCTGGGCTACAGGGAACATAACAGTTGTTCCAATTGTTAAAACAGTTGGTCTTGGACTGGGTCTGTTAATTTGGGCTTCATTTAATCTTCTAACTGGCTGGGCGAGTTCAAGGTTTGGCATGTTTGGAATAGACCCAGAAATTGTTGCTAACCCAAACTTAAATTATGCTGGAGCTGGTCTTTCAGCATTAAGTGCCGTCATTTTTTTGTTTGTGAAATCCGACGTAAACAGTGCCACATCAGTTTCAGAATCGGATATCACCCCGCTACTTAGCAATAGTCTTAATTCCCAGCAAAACATTGTTTCAGATGAATCATGGGTAGACAAGCTATCACCGCTGCAAAAACGATTGATAGGGTCTGCGATGGCAGTTGTAGCAGGAATTCTCTATGGCTCCAACTTTATCCCAGTTCTCTACATCAAGGACCACAGCAAAAATAATCCAAACAAAATGCTGGGTGCAACCCAGTTGAATTAGATTACGTCTTTGCACACTTTCTTGGAATTTTTCCTAAAAGATACATTCCATTTTTCTAAATATACTGGGCATAAATGAAAAATTCCCCCCAAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAAACCTAATTACAGCTGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839047
dbEST ID: 79656749
Trimmed Sequence: TTTCTTAGAGAAACCCGTTAATAGAGAACCGGACACGACAATGCAGAAGGCTAAAACTAGCAGCAAATAGTTTCTCATTCCCTTTATTTCCTTGAAAACTAAGACTCCCCACATTGCAGCTATTATTCCTGGCCCTGCGGTTATAATTGGAAAGCTGACAACAGCGCTAAGGTAATTATTAGCCAGGAACCAGCAACAAGTAGCAATTGCCCAAAGTACACCAGAAACAAAACCTGGCAGTATTGCTTGTGGATAAACTTTCGGGTGATTTTTCATTATTGCGCAGTATATCAGAAAATAGACTGTACTTGTTAGGAAAATTCCACTGAAGTGTGCAAAGACGTAATCTAAATCAAATTGGCTTGCACCAGCATATATGCTCTGATTATTTTTGCTGTGGTCCTTGATGTAGAGAACTGGGATAAAGTTGGAGCCATAGAGAATTCCTGCTACAACTGCCATCGCAGACCCTATCAATCGTTTTTGCAGCGGTGATAGCTTGTCTACCCATGATTCATCTGAAACAATGTTTTGCTGGGAATTAAGACTATTGCTAAGTAGCGGGGTGGTATCCGATTCTGAAACTGAAGTGGCACTGGTTTAGTTCGGAATTCCCCAAACAAAAAAAGAACGGCACTTAATGCTGGAAGGAACAGCTCCCCCCTAATTTTAAGTTTTGGGTTAAGCACCGATTTTCGGGGGGCTATTTCAAAAACAGGCCCCAACCCCTTTAAACTCCCCCCCCCCCCGGCTTTAAAAAAATT
Full Trace Sequence: GAGGAAACTGCTAGTGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTAGAGAAACCCGTTAATAGAGAACCGGACACGACAATGCAGAAGGCTAAAACTAGCAGCAAATAGTTTCTCATTCCCTTTATTTCCTTGAAAACTAAGACTCCCCACATTGCAGCTATTATTCCTGGCCCTGCGGTTATAATTGGAAAGCTGACAACAGCGCTAAGGTAATTATTAGCCAGGAACCAGCAACAAGTAGCAATTGCCCAAAGTACACCAGAAACAAAACCTGGCAGTATTGCTTGTGGATAAACTTTCGGGTGATTTTTCATTATTGCGCAGTATATCAGAAAATAGACTGTACTTGTTAGGAAAATTCCACTGAAGTGTGCAAAGACGTAATCTAAATCAAATTGGCTTGCACCAGCATATATGCTCTGATTATTTTTGCTGTGGTCCTTGATGTAGAGAACTGGGATAAAGTTGGAGCCATAGAGAATTCCTGCTACAACTGCCATCGCAGACCCTATCAATCGTTTTTGCAGCGGTGATAGCTTGTCTACCCATGATTCATCTGAAACAATGTTTTGCTGGGAATTAAGACTATTGCTAAGTAGCGGGGTGGTATCCGATTCTGAAACTGAAGTGGCACTGGTTTAGTTCGGAATTCCCCAAACAAAAAAAGAACGGCACTTAATGCTGGAAGGAACAGCTCCCCCCTAATTTTAAGTTTTGGGTTAAGCACCGATTTTCGGGGGGCTATTTCAAAAACAGGCCCCAACCCCTTTAAACTCCCCCCCCCCCCGGCTTTAAAAAAATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTAGAGAAACCCGTTAATAG