ORFeome > tmem194a ORF2 – XORFeome v1.0

tmem194a ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem194a
Gene ID: 974580
Gene Page ID: 974572
ORF Xenbase ID: 17301375

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130092
Original XGC clone length: 1305

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ837606
dbEST ID: 79655308
Trimmed Sequence: ATGGCGGGAGAAGTGGAAGGAAGAGGCTGCGGATTTAGTTTGGGAGTCCTGGTAACCTTGCTGGTATTACCACTGCCGTCATTATGTACCTTGAGCACAGAAAAGGAACTACATGTGATTAAACTCTATGAAGGGAGAATGGTCCGGTATAATGAGTCAAGAAATTTCTGCTACCAGAGAACATATGAACCAAAATGGAGTGATGTTTGGACTAAGATACAGATACGTATAAACAGCACTAAAATGATAAGAGTGACCCAAGTGGATAATGAAGAGAAGCTGAAGGAAATGGAAACTTTCAACATGTTTGACTTTTTCTCATCTTTTCTCAAGGAGAAACTGAATGATACATTCATATATGTGAATCTCTACAGCAACAAAACTTGTGTCAAAGTGCATTTAACAGACACCGACACTTACTACAGTGTTGCACTTTCTCGAGGATTTGATCCAAGACTCTTCTTTGTTTTCTTATGCGGTCTTCTACTATTCTTTTATGGTGACACTCTGAGCAGAAGCCAACTCTTTTTCTATATCACAGGAATCACTGTACGAATGTTGGCTTCAGTGCTGATACTTGTGTTCATGCTCTCCAAACTGATGCCCAAGAAAATTCCATTTTTTGCGTTACTGCTTGGAGGAGGGTCGGTCTCCATTTACTTAATCCAACTGGTCTTCAGAATTTTCAAGAAATCTGCAGTGAGTAACTGGCAGGAGCCTATTGTGTTACCGGGGTATTTGTGGGAATTTGTTCGGCTTGTGCTTTTTCTTCAATTATTATTGGAA
Full Trace Sequence: CGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGGAGAAGTGGAAGGAAGAGGCTGCGGATTTAGTTTGGGAGTCCTGGTAACCTTGCTGGTATTACCACTGCCGTCATTATGTACCTTGAGCACAGAAAAGGAACTACATGTGATTAAACTCTATGAAGGGAGAATGGTCCGGTATAATGAGTCAAGAAATTTCTGCTACCAGAGAACATATGAACCAAAATGGAGTGATGTTTGGACTAAGATACAGATACGTATAAACAGCACTAAAATGATAAGAGTGACCCAAGTGGATAATGAAGAGAAGCTGAAGGAAATGGAAACTTTCAACATGTTTGACTTTTTCTCATCTTTTCTCAAGGAGAAACTGAATGATACATTCATATATGTGAATCTCTACAGCAACAAAACTTGTGTCAAAGTGCATTTAACAGACACCGACACTTACTACAGTGTTGCACTTTCTCGAGGATTTGATCCAAGACTCTTCTTTGTTTTCTTATGCGGTCTTCTACTATTCTTTTATGGTGACACTCTGAGCAGAAGCCAACTCTTTTTCTATATCACAGGAATCACTGTACGAATGTTGGCTTCAGTGCTGATACTTGTGTTCATGCTCTCCAAACTGATGCCCAAGAAAATTCCATTTTTTGCGTTACTGCTTGGAGGAGGGTCGGTCTCCATTTACTTAATCCAACTGGTCTTCAGAATTTTCAAGAAATCTGCAGTGAGTAACTGGCAGGAGCCTATTGTGTTACCGGGGTATTTGTGGGAATTTGTTCGGCTTGTGCTTTTTCTTCAATTATTATTGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGGAGAAGTGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837605
dbEST ID: 79655307
Trimmed Sequence: AAAGACAGATCTTGGAATTGGATAAAGTGGCGGTTCAATTTCCATTTCTTCCTCAACATCGCTGTCCTCTCCAAACAATTCATCTTCTAAGAAAGAACCACCTAAACCATACTCGTGCTCATGAACGGATACTTCATTGGGTGTCAGGTGAGATGAGCCTTCAACAAAATCAGCAAATCTCTTGGGTGACTGGATGCGAGAAATCGTTTTCCATGCTGCAAAATCTGGACTACTGCAACATTCTCGTAATTCCTCCAAAGCTTTCCTGGTCTCAACATCTGCTTGTTTTCTGTATTCTTCTTCTGTTAGCAAGCGGGGTGGGCCCGGCTTAGCTCTCTTTAGTTTTATTTTTCTGTATAGTATGTAAATCCACTGTACTGGATATTCTATCTGTTTGGTACAAAATGCAATGACTACTATAGTCACTGCTATGTGCTGTATTTGCACACTGACGTACATTAGCAGCAGACCAATTAACTGTAATGTCCAGTTCAAAATGTTGATGCTGCGTTCATTCTCCAATGGCCCGGATATATAACAGGAAGCAAAGCTGACAAATCCAACAATACCCAGATACACAATAAAATACTGCCGGTACTCAGTGGCGAATGCCTGTTAATTTTCTGAAAACCGGTTGGAATAAATTAAATAAAAACAGAACCTCCGCCCAAGCGGGTACCCCAAAAAAAGGGACGTTTCTGTTGGTGTTGGTTTTTGGGGAACCTTGTAAACCAGGGGATACAACAATTTTAAGGCCAACCCGTGCCCAAAAGGGGGAAT
Full Trace Sequence: GGCAAAACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAGACAGATCTTGGAATTGGATAAAGTGGCGGTTCAATTTCCATTTCTTCCTCAACATCGCTGTCCTCTCCAAACAATTCATCTTCTAAGAAAGAACCACCTAAACCATACTCGTGCTCATGAACGGATACTTCATTGGGTGTCAGGTGAGATGAGCCTTCAACAAAATCAGCAAATCTCTTGGGTGACTGGATGCGAGAAATCGTTTTCCATGCTGCAAAATCTGGACTACTGCAACATTCTCGTAATTCCTCCAAAGCTTTCCTGGTCTCAACATCTGCTTGTTTTCTGTATTCTTCTTCTGTTAGCAAGCGGGGTGGGCCCGGCTTAGCTCTCTTTAGTTTTATTTTTCTGTATAGTATGTAAATCCACTGTACTGGATATTCTATCTGTTTGGTACAAAATGCAATGACTACTATAGTCACTGCTATGTGCTGTATTTGCACACTGACGTACATTAGCAGCAGACCAATTAACTGTAATGTCCAGTTCAAAATGTTGATGCTGCGTTCATTCTCCAATGGCCCGGATATATAACAGGAAGCAAAGCTGACAAATCCAACAATACCCAGATACACAATAAAATACTGCCGGTACTCAGTGGCGAATGCCTGTTAATTTTCTGAAAACCGGTTGGAATAAATTAAATAAAAACAGAACCTCCGCCCAAGCGGGTACCCCAAAAAAAGGGACGTTTCTGTTGGTGTTGGTTTTTGGGGAACCTTGTAAACCAGGGGATACAACAATTTTAAGGCCAACCCGTGCCCAAAAGGGGGAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAGACAGATCTTGGAATTGGATA