ORFeome > tmem206 ORF1 – XORFeome v1.0

tmem206 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem206
Gene ID: 985609
Gene Page ID: 985603
ORF Xenbase ID: 17301405

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123202
Original XGC clone length: 1053

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ838296
dbEST ID: 79655998
Trimmed Sequence: ATGGAAGCGATAAGGAAGGAGCTGTCCCGGTCGTACCAAGAGCTCAACGACGAAACAGATCCAATTGCAAGAGATCCAGAGGGGGCGCAGGAGGAGGAGCAGGAAGAAGCTGCGTCCGCTGTTGTACCCGACAGGGATTCGGATAGGAGCAACACTCGGGTGCATTTCAGCAGAACCTGCCTGAAGAACGTCTTCTCCGTTTTGCTCATCTTCGTGTATCTGCTCCTAATGGGCGTGGCGGTTTTCCTCGTGTATCAGACCATCACCGACTTCAGGGATAAACTGAAACATCCGGTCATGTCCGTGTCGTATAAAGAGGTGAACGTGTACGATGCTCCCGGTATTGCCCTGTATCCAGGCAAAGCTCGGCTTCTGAGCTGCAAACATCACTTGTACGACCACATCCCTCCTCTGATAGACCCGGGGCAGCCGGGAGAAAACACTTGTATCACCCAGAACATCAGCTACACTGATCCTTACACCAACAGCACTGTGAAACACGCGCTGATTGTCCAAGGGCCGCGGGACGTGAGGAGGAGGGAACTGGTTTTCTTACAGTTCCACTTAAATGAAACGAAACAAGATTTCAGCGCAATCGATTACCTGCTGTTCTCCTCGTACGACGCTTTTCTCAGAATACTAAACCGGGTGAGGTTCATGCAGGACTGTGAGAGCTCGTTCTCCACCTGGAAGTTCTCCCGAAGATTTCGCACGTGGGTTAAAATGTCCCTGGTCCAACCCAAAGAAGAAGAAGGAAAGCCCACCCGTGGAAATTCCAAAAAAAAAAACCCGTGGGGGGGTAAAT
Full Trace Sequence: GGCCCCAATAATTGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGCGATAAGGAAGGAGCTGTCCCGGTCGTACCAAGAGCTCAACGACGAAACAGATCCAATTGCAAGAGATCCAGAGGGGGCGCAGGAGGAGGAGCAGGAAGAAGCTGCGTCCGCTGTTGTACCCGACAGGGATTCGGATAGGAGCAACACTCGGGTGCATTTCAGCAGAACCTGCCTGAAGAACGTCTTCTCCGTTTTGCTCATCTTCGTGTATCTGCTCCTAATGGGCGTGGCGGTTTTCCTCGTGTATCAGACCATCACCGACTTCAGGGATAAACTGAAACATCCGGTCATGTCCGTGTCGTATAAAGAGGTGAACGTGTACGATGCTCCCGGTATTGCCCTGTATCCAGGCAAAGCTCGGCTTCTGAGCTGCAAACATCACTTGTACGACCACATCCCTCCTCTGATAGACCCGGGGCAGCCGGGAGAAAACACTTGTATCACCCAGAACATCAGCTACACTGATCCTTACACCAACAGCACTGTGAAACACGCGCTGATTGTCCAAGGGCCGCGGGACGTGAGGAGGAGGGAACTGGTTTTCTTACAGTTCCACTTAAATGAAACGAAACAAGATTTCAGCGCAATCGATTACCTGCTGTTCTCCTCGTACGACGCTTTTCTCAGAATACTAAACCGGGTGAGGTTCATGCAGGACTGTGAGAGCTCGTTCTCCACCTGGAAGTTCTCCCGAAGATTTCGCACGTGGGTTAAAATGTCCCTGGTCCAACCCAAAGAAGAAGAAGGAAAGCCCACCCGTGGAAATTCCAAAAAAAAAAACCCGTGGGGGGGTAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGCGATAAGGAAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838295
dbEST ID: 79655997
Trimmed Sequence: GCTTATGTGGTTCAGTTCCCGAGTTCTCTTCTTCAGGTGTCTCCTCCGGACCTTTATCATCCACTTAACACTGAGTTTGGCAAAATCCGCCGCTTTAAATAAAACCAGAAAGACGCTGCACAGCAGAGCGATCATACTCCATGGATTGGCCGTGATGATGTCTTGAATTTCTTGAATATACGGATCCTTCCATTCAAAAACGACGAAGAACAATTGGTCCCCCTTATCTGGATTTTCTCTCCGATCAATGAAATTCACCACACTGGTTTCTTGTCTGAATTCCACTGATTGGCTTCCATCTTCCTCTTTTGTTTTGACCAGCGACATTTTAACCCACGTGCGAAATCCTCCGGAGAATTTCCAGCTGGAGAAGGAGCTCTCACAGTCCTGCATGAACCTCACCCGGTTAGTACTCTTGAGAAAAGCGTCGTACGAGGAGAACAGCAGGTAATCGATTGCGCTGAAATCTTGTTTCGTTTCATTTAAGTGGAACTGTAAGAAAACCAGTTCCCTCCTCCTCACGTCCCGCGGCCCTTGGACAATCAGCGCGTGTTTCACAGTGGCTGTTGGTGTAAGGATCAATGGTACTGATGTTCTGCGTGATACAAGTGTTTTTCTCCCCGCTTCCGCCCGGCTCTATCAAGGAAGGAATGTGTTTCCTACCAAGTTAATGTTTGCGAGCTCAGAAACCCCAAACCTTTTCCCCGGGATAACA
Full Trace Sequence: GGGAATCTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTTATGTGGTTCAGTTCCCGAGTTCTCTTCTTCAGGTGTCTCCTCCGGACCTTTATCATCCACTTAACACTGAGTTTGGCAAAATCCGCCGCTTTAAATAAAACCAGAAAGACGCTGCACAGCAGAGCGATCATACTCCATGGATTGGCCGTGATGATGTCTTGAATTTCTTGAATATACGGATCCTTCCATTCAAAAACGACGAAGAACAATTGGTCCCCCTTATCTGGATTTTCTCTCCGATCAATGAAATTCACCACACTGGTTTCTTGTCTGAATTCCACTGATTGGCTTCCATCTTCCTCTTTTGTTTTGACCAGCGACATTTTAACCCACGTGCGAAATCCTCCGGAGAATTTCCAGCTGGAGAAGGAGCTCTCACAGTCCTGCATGAACCTCACCCGGTTAGTACTCTTGAGAAAAGCGTCGTACGAGGAGAACAGCAGGTAATCGATTGCGCTGAAATCTTGTTTCGTTTCATTTAAGTGGAACTGTAAGAAAACCAGTTCCCTCCTCCTCACGTCCCGCGGCCCTTGGACAATCAGCGCGTGTTTCACAGTGGCTGTTGGTGTAAGGATCAATGGTACTGATGTTCTGCGTGATACAAGTGTTTTTCTCCCCGCTTCCGCCCGGCTCTATCAAGGAAGGAATGTGTTTCCTACCAAGTTAATGTTTGCGAGCTCAGAAACCCCAAACCTTTTCCCCGGGATAACA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTTATGTGGTTCAGTTCCCGAGT