ORFeome > tmem208 ORF1 – XORFeome v1.0

tmem208 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem208
Gene ID: 941120
Gene Page ID: 941116
ORF Xenbase ID: 17301411

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123134
Original XGC clone length: 525

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: JZ838042
dbEST ID: 79655744
Trimmed Sequence: ATGGCGCCCAAAGGTAAGGTTGGAACTAAAGGAAAGAAGCAGATTTATGAAGAAAATAAGGAGACATTAAGTTTCTACTTGCGCATCATCCTTGGAGCTACAGTATTATGTGGAGCTATTAATCTGGGAGTGTTTTACAGCTCTTCAAATTTCTGGACTTGGGCAACACTGGTGTTCAGTGGGATAGTGTATGCTGGAGCTTATCGTTCTATGAGAAGCATGGCACAGGCATCTTTTTCAGAAGATGGGAGCCTTCTAGATGGAGGAATTGACCTAAACATGGAGCAAGGAATGGCAGAACATATCAAGGATATTGTGTTGCTGACAGCAATTGTACAGGTCCTTAGCTGTTTTTCACTGTACTTCTGGTACTTCTGGCTTTTGGCTCCTGGCCGTGCACTGTATCTGCTCTGGGTTAATGTTCTTGGTCCTTGGTTTACTGCTGATAATTCTTCTACAGTTCCACAAGAGCAAAATGAAAAACGGCAACGTCGTCAAGAAAGAAGGCAAATGAAGAGATTCTT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCCCAAAGGTAAGGTTGGAACTAAAGGAAAGAAGCAGATTTATGAAGAAAATAAGGAGACATTAAGTTTCTACTTGCGCATCATCCTTGGAGCTACAGTATTATGTGGAGCTATTAATCTGGGAGTGTTTTACAGCTCTTCAAATTTCTGGACTTGGGCAACACTGGTGTTCAGTGGGATAGTGTATGCTGGAGCTTATCGTTCTATGAGAAGCATGGCACAGGCATCTTTTTCAGAAGATGGGAGCCTTCTAGATGGAGGAATTGACCTAAACATGGAGCAAGGAATGGCAGAACATATCAAGGATATTGTGTTGCTGACAGCAATTGTACAGGTCCTTAGCTGTTTTTCACTGTACTTCTGGTACTTCTGGCTTTTGGCTCCTGGCCGTGCACTGTATCTGCTCTGGGTTAATGTTCTTGGTCCTTGGTTTACTGCTGATAATTCTTCTACAGTTCCACAAGAGCAAAATGAAAAACGGCAACGTCGTCAAGAAAGAAGGCAAATGAAGAGATTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCATTCCAAAAAAAATATTATTTGCCATCCAGCTGAATATCCCTATAATGAGTCCTATTACTGAAAAAAAAAAGAATAAATAAAAAAAAAAGGGGGTCCCAGAATCCACAAAAAAAAAAGCAAAAAAACAGCGCCTCTTTTTTCCGGTTGGGTGTTCGGGGTGGTGAGTTGGGAGAAAAAAAACGGGAAAGGCGATTGTGGGGGTTTATTAATGGGGGGATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCCCAAAGGTAAGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838041
dbEST ID: 79655743
Trimmed Sequence: GAATCTCTTCATTTGCCTTCTTTCTTGACGACGTTGCCGTTTTTCATTTTGCTCTTGTGGAACTGTAGAAGAATTATCAGCAGTAAACCAAGGACCAAGAACATTAACCCAGAGCAGATACAGTGCACGGCCAGGAGCCAAAAGCCAGAAGTACCAGAAGTACAGTGAAAAACAGCTAAGGACCTGTACAATTGCTGTCAGCAACACAATATCCTTGATATGTTCTGCCATTCCTTGCTCCATGTTTAGGTCAATTCCTCCATCTAGAAGGCTCCCATCTTCTGAAAAAGATGCCTGTGCCATGCTTCTCATAGAACGATAAGCTCCAGCATACACTATCCCACTGAACACCAGTGTTGCCCAAATCCAGAAATTTGAAGAGCTGTAAAACACTCCCAGATTAATAGCTCCACATAATACTGTAGCTCCCAGGATGATGCGCAAGTAGAAACTTAATGTCTCCTTATTTTCTTCATAAATCTGCTTCTTTCCTTTAGTTCCGACCTTACCTTTGGGCGCCGGGG
Full Trace Sequence: AAAACGGCTATTGACGCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAATCTCTTCATTTGCCTTCTTTCTTGACGACGTTGCCGTTTTTCATTTTGCTCTTGTGGAACTGTAGAAGAATTATCAGCAGTAAACCAAGGACCAAGAACATTAACCCAGAGCAGATACAGTGCACGGCCAGGAGCCAAAAGCCAGAAGTACCAGAAGTACAGTGAAAAACAGCTAAGGACCTGTACAATTGCTGTCAGCAACACAATATCCTTGATATGTTCTGCCATTCCTTGCTCCATGTTTAGGTCAATTCCTCCATCTAGAAGGCTCCCATCTTCTGAAAAAGATGCCTGTGCCATGCTTCTCATAGAACGATAAGCTCCAGCATACACTATCCCACTGAACACCAGTGTTGCCCAAATCCAGAAATTTGAAGAGCTGTAAAACACTCCCAGATTAATAGCTCCACATAATACTGTAGCTCCCAGGATGATGCGCAAGTAGAAACTTAATGTCTCCTTATTTTCTTCATAAATCTGCTTCTTTCCTTTAGTTCCGACCTTACCTTTGGGCGCCGGGGTGCCACGTTTTTGTACAAAGTTGGCATTATAAATAATCATTGCTCAGCAGTTTGTTTTCCTCGAACAAGTCACAATCGTTCCGAATCGAATCCTTAAATAAAAAAAAGAAGCTAATAAATCAAAATATTGTAACTCCTATCTCACCAGAACAAAAAAAGCCCCCGCTCACTCCCTCTTTGTTTTCCGTGTGGGTTGTGGGCGTGGGGGAACAATGGAAGGGAGAGACACCCAAGGGGGGAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAATCTCTTCATTTGCCTTCTTTC