ORFeome > tmem241 ORF1 – XORFeome v1.0

tmem241 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem241
Gene ID: 6255834
Gene Page ID: 971852
ORF Xenbase ID: 17301447

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130081
Original XGC clone length: 891

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ837624
dbEST ID: 79655326
Trimmed Sequence: ATGTATTTTAGGGGACCCGCCGTGGGTCTCACCTTCTGCTGCTTTTATTTGTCTTCCTATTTCACAAATAAGTATGTCTTGTCTGTCTTGAAATTCACATACCCCACTCTTTTCCAAGGGTGGCAGACCTTAGTGGGTGGGCTTATCCTTCACATATGTTGGAAAGTGGGCTGGTTGGAAATTAACTGCAATTCCAGATCAGATGTTGTACTGTGGCTGCCTGGATGTGCACTCTTTGTTGGAATTATTTATGCTGGTTCCAGGGCACTGTCAAGGCTGCCCATCCCAGTGTTCTTCACCTTGCACAATGCAGCCGAAGTTGTGAGCTATGGATTTCAGAGACTGCTATTCAGAGAGAAATGTCCTTATTCAAAGATTTTCAGTATCTTTTTGCTGCTGCTTTCTGCTGGGTGCCTTCCATTACATGATCCCCAGTTTGATGCTGATGGTTATTTTTGGGCTGTAATTCACCTGTTCTGTGTAGGATGCTACAAAGTATTCAAAAAGTCGCAAAAATCAAGTTCACTAAGTGACCTTGATCAACAGTATATAAACTATGTGTTCAGTGTTGTGCTATTGGGCCTTGCATCCCACCCAACCAGAGACCTCATCATTGCCTTGGAGTTTCAATTTCTCTATTTCTACAAATTCCACTCCAGGATGTTGTGGCGGCGGGGAAACTGGGGCTTCATACTAAATGCTGCCTTACTGTTAACTTAATGAATAAACGCCTAAACCTT
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTATTTTAGGGGACCCGCCGTGGGTCTCACCTTCTGCTGCTTTTATTTGTCTTCCTATTTCACAAATAAGTATGTCTTGTCTGTCTTGAAATTCACATACCCCACTCTTTTCCAAGGGTGGCAGACCTTAGTGGGTGGGCTTATCCTTCACATATGTTGGAAAGTGGGCTGGTTGGAAATTAACTGCAATTCCAGATCAGATGTTGTACTGTGGCTGCCTGGATGTGCACTCTTTGTTGGAATTATTTATGCTGGTTCCAGGGCACTGTCAAGGCTGCCCATCCCAGTGTTCTTCACCTTGCACAATGCAGCCGAAGTTGTGAGCTATGGATTTCAGAGACTGCTATTCAGAGAGAAATGTCCTTATTCAAAGATTTTCAGTATCTTTTTGCTGCTGCTTTCTGCTGGGTGCCTTCCATTACATGATCCCCAGTTTGATGCTGATGGTTATTTTTGGGCTGTAATTCACCTGTTCTGTGTAGGATGCTACAAAGTATTCAAAAAGTCGCAAAAATCAAGTTCACTAAGTGACCTTGATCAACAGTATATAAACTATGTGTTCAGTGTTGTGCTATTGGGCCTTGCATCCCACCCAACCAGAGACCTCATCATTGCCTTGGAGTTTCAATTTCTCTATTTCTACAAATTCCACTCCAGGATGTTGTGGCGGCGGGGAAACTGGGGCTTCATACTAAATGCTGCCTTACTGTTAACTTAATGAATAAACGCCTAAACCTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTATTTTAGGGGACCCGCCGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ837623
dbEST ID: 79655325
Trimmed Sequence: CACTCCTGTTCTCTCTGCATACACCAGAACAGCTTCTCCAAGGCCACCAGCCAGCAAACATAAAGTCAGCGGTACAGTCAGAGTAATCTGAAAATAAATCAGCGACAGACCAGCAGTAATAACCTTAGCCACGAAATTCCAGGACGCATGTTGAACAGATGAGAGGTTACTCCTCAACTTAACAGAAGCGAGCATCAGTAAGAAGCCCAGTATCCCGCTGGCACAACACCCAGAGTGGAATCTGTAGAAATAGAGAAATGGAAACTCCAAGGCACTGATGAGGTCTCCGGTTGGGTGGGATGCAAGGCCCAATAGCACAACACTGAACACATAGTTTATATACTGTTGATCAAGGTCACTTAGTGAACCTGACTTCTGCGACTTTTTGAATACTTTGTAGCATCCTACACAGAACAGGTGAATTACAGCCCAAAAATAACCATCAGCATCAAACTGGGGATCATGTAATGGAAGGCACCCAGCAGAAAGCAGCAGCAAAAAGATACTGAAAATCTTTGAATAAGGACATTTCTCTCTGAATAACATTCTCTGAAATCCATAACTCACAACTTCCGCTGCATTGTGCAAGGTGAAAAAAACTGGGAAGGGGCAGCCTTGACAGTGCCCTGGAACCAGCAAAAATAATTCCAACAAAAAATGCACATCCCGGGCGCCCACAGTACAACATTCTAAACCGGGAATTTGAGATATAATTCCCAAACAAGCCCCCCTTTTCCCAAACAGATATTTGAAAGGGAAAAAA
Full Trace Sequence: GGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACTCCTGTTCTCTCTGCATACACCAGAACAGCTTCTCCAAGGCCACCAGCCAGCAAACATAAAGTCAGCGGTACAGTCAGAGTAATCTGAAAATAAATCAGCGACAGACCAGCAGTAATAACCTTAGCCACGAAATTCCAGGACGCATGTTGAACAGATGAGAGGTTACTCCTCAACTTAACAGAAGCGAGCATCAGTAAGAAGCCCAGTATCCCGCTGGCACAACACCCAGAGTGGAATCTGTAGAAATAGAGAAATGGAAACTCCAAGGCACTGATGAGGTCTCCGGTTGGGTGGGATGCAAGGCCCAATAGCACAACACTGAACACATAGTTTATATACTGTTGATCAAGGTCACTTAGTGAACCTGACTTCTGCGACTTTTTGAATACTTTGTAGCATCCTACACAGAACAGGTGAATTACAGCCCAAAAATAACCATCAGCATCAAACTGGGGATCATGTAATGGAAGGCACCCAGCAGAAAGCAGCAGCAAAAAGATACTGAAAATCTTTGAATAAGGACATTTCTCTCTGAATAACATTCTCTGAAATCCATAACTCACAACTTCCGCTGCATTGTGCAAGGTGAAAAAAACTGGGAAGGGGCAGCCTTGACAGTGCCCTGGAACCAGCAAAAATAATTCCAACAAAAAATGCACATCCCGGGCGCCCACAGTACAACATTCTAAACCGGGAATTTGAGATATAATTCCCAAACAAGCCCCCCTTTTCCCAAACAGATATTTGAAAGGGAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTCCTGTTCTCTCTGCAT