ORFeome > tmem242 ORF1 – XORFeome v1.0

tmem242 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tmem242
Gene ID: 6077997
Gene Page ID: 948362
ORF Xenbase ID: 17301453

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082742
Original XGC clone length: 438

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ839779
dbEST ID: 79657481
Trimmed Sequence: ATGGGGACACAGAAAGCGCTGAACGAGCAGAGCCTGACTAGTGAGACCGACACGGGCAGGAGGGAAGAAAAAATTGTTTCTTATTAAAGGTGGGATTTTCCTTGGCATGGTTGCAACTGCAGGAATGTTTGCTGGTTTCGGCACAACACTGTCTCTAGCAAAAAAGAGGAGTCCCAATTGGTTTAATAAGGGTGTCGCTGCAACAGCTACGCTGCCAGAAAGTGGCTCTTCACTTGCTCTGCGAGCTTTGGGATGGGGGTCTCTTTATGCTTGGTGTGGTGTGGGATTAATCAGTTTTGCAGTATGGAAAGCACTCGGGGTGCACAGTCTTAAAGACTTCAGGGAGAAAATGCAAACCATATTTCCAACTGTGTCAAAAGACCCAGAGCACCAGCCTACGTCGGAATTTAGCTTTGAAGATCTTTTGAAATCCAAGTT
Full Trace Sequence: GCTTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGACACAGAAAGCGCTGAACGAGCAGAGCCTGACTAGTGAGACCGACACGGGCAGGAGGGAAGAAAAAATTGTTTCTTATTAAAGGTGGGATTTTCCTTGGCATGGTTGCAACTGCAGGAATGTTTGCTGGTTTCGGCACAACACTGTCTCTAGCAAAAAAGAGGAGTCCCAATTGGTTTAATAAGGGTGTCGCTGCAACAGCTACGCTGCCAGAAAGTGGCTCTTCACTTGCTCTGCGAGCTTTGGGATGGGGGTCTCTTTATGCTTGGTGTGGTGTGGGATTAATCAGTTTTGCAGTATGGAAAGCACTCGGGGTGCACAGTCTTAAAGACTTCAGGGAGAAAATGCAAACCATATTTCCAACTGTGTCAAAAGACCCAGAGCACCAGCCTACGTCGGAATTTAGCTTTGAAGATCTTTTGAAATCCAAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACNNTGAAAAATAAAAAAAAACAAGACAACTCTGGACCGTGTCTCAATCGCCCCCAAACGTTACAAAAAAAAAAGGGCCTCTCTTGGCCTCCCCTGTTGTTTTGGGTGGGTGTCTTGGGGGGAGGGGTGGGGGGGAAAAACAAAGGAAAAAAAAAGTGTTTGGGGTTGTTGAGGGGGGGGTGGGGGGGGGGGCGCCCCCCCCGGGGCAAAAAAACATAACAAAAAAAGGGGGGGGAGGGCGCGCCGGGGGGGTTTTTTGTTTGTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGACACAGAAAGCG

Sequences - 3ʹ (reverse) EST

Accession: JZ839778
dbEST ID: 79657480
Trimmed Sequence: CTTGGATTTCAAAAGATCTTCAAAGCTAAATTCCGACGTAGGCTGGTGCTCTGGGTCTTTTGACACAGTTGGAAATATGGTTTGCATTTTCTCCCTGAAGTCTTTAAGACTGTGCACCCCGAGTGCTTTCCATACTGCAAAACTGATTAATCCCACACCACACCAAGCATAAAGAGACCCCCATCCCAAAGCTCGCAGAGCAAGTGAAGAGCCACTTTCTGGCAGCGTAGCTGTTGCAGCGACACCCTTATTAAACCAATTGGGACTCCTCTTTTTTGCTAGAGACAGTGTTGTGCCGAAACCAGCAAACATTCCTGCAGTTGCAACCATGCCAAGGAAAATCCCACCTTTAATAAGAAACAATTTCTCTTCCCTCCTGCCCGTGTCGGTCTCACTAGTCAGGCTCTGCTCGTTCAGCGCTTTCTGTGTCCCCATGG
Full Trace Sequence: GGGGAAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTGGATTTCAAAAGATCTTCAAAGCTAAATTCCGACGTAGGCTGGTGCTCTGGGTCTTTTGACACAGTTGGAAATATGGTTTGCATTTTCTCCCTGAAGTCTTTAAGACTGTGCACCCCGAGTGCTTTCCATACTGCAAAACTGATTAATCCCACACCACACCAAGCATAAAGAGACCCCCATCCCAAAGCTCGCAGAGCAAGTGAAGAGCCACTTTCTGGCAGCGTAGCTGTTGCAGCGACACCCTTATTAAACCAATTGGGACTCCTCTTTTTTGCTAGAGACAGTGTTGTGCCGAAACCAGCAAACATTCCTGCAGTTGCAACCATGCCAAGGAAAATCCCACCTTTAATAAGAAACAATTTCTCTTCCCTCCTGCCCGTGTCGGTCTCACTAGTCAGGCTCTGCTCGTTCAGCGCTTTCTGTGTCCCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCACGAGCATAACACTGGACGTCGTTTTACACATCAGTTAAACTGGGATTTTCCCAAGAAGCTTCTGCCCCTTTTCCCAAATCTGCTGATGGTTTCAAGANNATNNGGNGGGGAAAAAGACAAAAAAACAAAACAATAACAATACTTGTATATTTTTTGATAAGAGGGCAGGTGGGGGGGCCGNCATACACAAAAACAACAAAAAAAAAAAAAAAAAAGAAGNGTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTGGATTTCAAAAGATCTTC