ORFeome > tmem248 ORF1 – XORFeome v1.0

tmem248 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tmem248
Gene ID: 5803899
Gene Page ID: 5803740
ORF Xenbase ID: 17301465

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053800
Original XGC clone length: 948

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ839572
dbEST ID: 79657274
Trimmed Sequence: ATGATTCTGACCTTACATCCCCTGGAGAACCTGAAGTCCTACATCAACAGCCGGCCACCTCTGGTGATTTTTATGGTCAGTGTAAGTGGAATGGCCATAGCCTTCCTAACACTTGGTTATTTCTTCAAAATGAAAGAGATCAAGTCACCGGAAATGACTGAGGACTGGAACACCTTCCTCCTGAGGTTTAACAATCTGGACTTGTGTGTATCTGACAATGAAACCTTAAAGCATTTTTTGAATGAAACCACCCCTCCTGAGAGCACAGTAACTTCCGGTCAAGCAAGGTCATCCACACAAACACCTCAAGCTCTAGAGGACTCTGGACCCATAAATATTTCTGTGGCAATTACCTTGACTTTAGATCCACTTAAACCCTTTGGTGGATATTCCCGTAACATCACACACCTGAGCTCAACCATTTTTGGTCATCAGATTGGTCTTTCAGGCAGAGATTCCCACGAGGAGATGAATATTACGTTCACTTTGCCTGCTGCGTGGAACTCTGATGAGTGTATTGTCCATGGGCACTGTGAGCAGGTGGTATTTACTACATGTATGACCGTCACTGCAGTGGCCAGTGTGTTTCCAGTCACAGTTCAGCCTCCTCACTGTATTCCTGAGACATACAGCAACGCTTCTTTGTGGTACAAGATGTTCACCACTGCTCGTGACTCAGGGACAAAGAACGCACACGACTAATAACCTTTCCTGGTGTTACAAGGGAAGCAATAGGCAAAGGTGTACCAGGGCTTTAAATCCCCAAACTCCCAAGTTATTTGGTGCCAAAAGGAAAGACCCGGT
Full Trace Sequence: TCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTCTGACCTTACATCCCCTGGAGAACCTGAAGTCCTACATCAACAGCCGGCCACCTCTGGTGATTTTTATGGTCAGTGTAAGTGGAATGGCCATAGCCTTCCTAACACTTGGTTATTTCTTCAAAATGAAAGAGATCAAGTCACCGGAAATGACTGAGGACTGGAACACCTTCCTCCTGAGGTTTAACAATCTGGACTTGTGTGTATCTGACAATGAAACCTTAAAGCATTTTTTGAATGAAACCACCCCTCCTGAGAGCACAGTAACTTCCGGTCAAGCAAGGTCATCCACACAAACACCTCAAGCTCTAGAGGACTCTGGACCCATAAATATTTCTGTGGCAATTACCTTGACTTTAGATCCACTTAAACCCTTTGGTGGATATTCCCGTAACATCACACACCTGAGCTCAACCATTTTTGGTCATCAGATTGGTCTTTCAGGCAGAGATTCCCACGAGGAGATGAATATTACGTTCACTTTGCCTGCTGCGTGGAACTCTGATGAGTGTATTGTCCATGGGCACTGTGAGCAGGTGGTATTTACTACATGTATGACCGTCACTGCAGTGGCCAGTGTGTTTCCAGTCACAGTTCAGCCTCCTCACTGTATTCCTGAGACATACAGCAACGCTTCTTTGTGGTACAAGATGTTCACCACTGCTCGTGACTCAGGGACAAAGAACGCACACGACTAATAACCTTTCCTGGTGTTACAAGGGAAGCAATAGGCAAAGGTGTACCAGGGCTTTAAATCCCCAAACTCCCAAGTTATTTGGTGCCAAAAGGAAAGACCCGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTCTGACCTTACATCCCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839571
dbEST ID: 79657273
Trimmed Sequence: TGCATCAGACAGGGCAACCTTTTCGGGGCGGAACTCAGAGTTGCTTTGTCTTAGTTTACTTGGTCTACCTCGGATCGCTGCATAACAGAACATGGTGATGACCATCACGAAGAGGAAGTAACTTGTGTCCATCAAATGCAGGTTTATGAGTGAACGGTCATCCTCTGACACAATAACTGTGAGTTTGGGATTTAAAGCATGGTACACCTTGCCTATTGCTCCCTTGTAACACCAGAAAGGATTATAGTCGTGTGCGTTCTTTGTCCCTGAGTCACGAGCAGTGGTGAACATCTTGTACCACAAAGAAGCGTTGCTGTATGTCTCAGGAATACAGTGAGGAGGCTGAACTGTGACTGGAAACACACTGGCCACTGCAGTGACGGTCATACATGTAGTAAATACCACCTGCTCACAGTGCCCATGGACAATACACTCATCAGAGTTCCACGCAGCAGGCAAAGTGAACGTAATATTCATCTCCTCGTGGGAATCTCTGCCTGAAAGACCAATCTGATGACCAAAAATGGTTGAGCTCAAGTGTGTGATGTTACGGGAATATCCACCAAAGGGTTTAGGTGAATCTTAAGTCAAGGTAATTGCCACAGAAGATATTATTGGTCCAAAATTCTCTAAAACTTGAAGTGTTTTGTGTGGATGACCTTGCTTTAACCCGAGTTTACTGGGCTGGCGGGAAGGGGGTGGGGTGGGGTCGGAAAATGGCTTTAAGAGGTCCTTTTGCCGGGAGGGGCACAAGAGTCCGAAATTTGCTTAAC
Full Trace Sequence: AAACGGCTATTGAACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCATCAGACAGGGCAACCTTTTCGGGGCGGAACTCAGAGTTGCTTTGTCTTAGTTTACTTGGTCTACCTCGGATCGCTGCATAACAGAACATGGTGATGACCATCACGAAGAGGAAGTAACTTGTGTCCATCAAATGCAGGTTTATGAGTGAACGGTCATCCTCTGACACAATAACTGTGAGTTTGGGATTTAAAGCATGGTACACCTTGCCTATTGCTCCCTTGTAACACCAGAAAGGATTATAGTCGTGTGCGTTCTTTGTCCCTGAGTCACGAGCAGTGGTGAACATCTTGTACCACAAAGAAGCGTTGCTGTATGTCTCAGGAATACAGTGAGGAGGCTGAACTGTGACTGGAAACACACTGGCCACTGCAGTGACGGTCATACATGTAGTAAATACCACCTGCTCACAGTGCCCATGGACAATACACTCATCAGAGTTCCACGCAGCAGGCAAAGTGAACGTAATATTCATCTCCTCGTGGGAATCTCTGCCTGAAAGACCAATCTGATGACCAAAAATGGTTGAGCTCAAGTGTGTGATGTTACGGGAATATCCACCAAAGGGTTTAGGTGAATCTTAAGTCAAGGTAATTGCCACAGAAGATATTATTGGTCCAAAATTCTCTAAAACTTGAAGTGTTTTGTGTGGATGACCTTGCTTTAACCCGAGTTTACTGGGCTGGCGGGAAGGGGGTGGGGTGGGGTCGGAAAATGGCTTTAAGAGGTCCTTTTGCCGGGAGGGGCACAAGAGTCCGAAATTTGCTTAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCATCAGACAGGGCAAC