ORFeome > tmem27 ORF1 – XORFeome v1.0

tmem27 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem27
Gene ID: 865599
Gene Page ID: 486324
ORF Xenbase ID: 17301507

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC058203
Original XGC clone length: 687

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11017
Well Location: E12

Sequences - 5ʹ (forward) EST

Accession: JZ824474
dbEST ID: 79642176
Trimmed Sequence: ATGCTTGGGGGAATTCTGCTCTTTCTTCTCTCTTTACCCACTTTTGTTCATGGAGATCTCTGTGAACCAGGTTCTCGCGGAGCACTTAAAGTTCGACTTAATATCAAAGCAGCTCTGGGCGACAATGCATACACATGGAACTCAGATGAAGAGTATCTCTTTAAGGCCGTGATGGCTTTTGTCATGCGAAGCTACACAAAGAACGACACTTTTCAGATTTCTAATATTGTGCTGTGCAATTCGACAGAGAGAGTCTCATTCTGGTTTGTCGTCACGTCTCCTTCCAATGAATCCCATCCCGTTTCCTATTCCGTTGTTGAGGCTGCAGTAAGAAATGAAAGAAACCGGATTAACAGCGCTTTCCTCTTGAATGACAAAACTCTGGAGTTTGTTCAGATTCCACCCACATTGGCCCCTGCTTCTCAGTCTTCCAGTTCCTCCTGGCTTATTGTATTTGGGGTGGTGGTTTTTGTTGTCTCTGTTGCGATTGCTTACCTTGTGGTATCTGGAGTTATACGGCACAGAAAAAGATTAAAGTCTTCGGAAGAAGAAAGTCAAAATTCTGAAGCTAGAATGAAATCTTTGGATGCAATAAAGAATGGCGGCCTTCATGATAAAACCATATTAACAGACAGTTTGGTGAATGACAGTTACGATTATACTGGAGACGCATACACAGCGTTCTT
Full Trace Sequence: CAATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTTGGGGGAATTCTGCTCTTTCTTCTCTCTTTACCCACTTTTGTTCATGGAGATCTCTGTGAACCAGGTTCTCGCGGAGCACTTAAAGTTCGACTTAATATCAAAGCAGCTCTGGGCGACAATGCATACACATGGAACTCAGATGAAGAGTATCTCTTTAAGGCCGTGATGGCTTTTGTCATGCGAAGCTACACAAAGAACGACACTTTTCAGATTTCTAATATTGTGCTGTGCAATTCGACAGAGAGAGTCTCATTCTGGTTTGTCGTCACGTCTCCTTCCAATGAATCCCATCCCGTTTCCTATTCCGTTGTTGAGGCTGCAGTAAGAAATGAAAGAAACCGGATTAACAGCGCTTTCCTCTTGAATGACAAAACTCTGGAGTTTGTTCAGATTCCACCCACATTGGCCCCTGCTTCTCAGTCTTCCAGTTCCTCCTGGCTTATTGTATTTGGGGTGGTGGTTTTTGTTGTCTCTGTTGCGATTGCTTACCTTGTGGTATCTGGAGTTATACGGCACAGAAAAAGATTAAAGTCTTCGGAAGAAGAAAGTCAAAATTCTGAAGCTAGAATGAAATCTTTGGATGCAATAAAGAATGGCGGCCTTCATGATAAAACCATATTAACAGACAGTTTGGTGAATGACAGTTACGATTATACTGGAGACGCATACACAGCGTTCTTGCCAACTTTCTTGGTACAAGTTGGCATTATAAGAAAGCATTGCTTATCATTTTNGTTGCACGGACAGGTCACTATCAGTCAAAATAAAATCATTATTTTGCCATCCAGCTGATATCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTTGGGGGAATTCTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829828
dbEST ID: 79647530
Trimmed Sequence: GAACGCTGTGTATGCGTCTCCAGTATAATCGTAACTGTCATTCACCAAACTGTCTGTTAATATGGTTTTATCATGAAGGCCGCCATTCTTTATTGCATCCAAAGATTTCATTCTAGCTTCAGAATTTTGACTTTCTTCTTCCGAAGACTTTAATCTTTTTCTGTGCCGTATAACTCCAGATACCACAAGGTAAGCAATCGCAACAGAGACAACAAAAACCACCACCCCAAATACAATAAGCCAGGAGGAACTGGAAGACTGAGAAGCAGGGGCCAATGTGGGTGGAATCTGAACAAACTCCAGAGTTTTGTCATTCAAGAGGAAAGCGCTGTTAATCCGGTTTCTTTCATTTCTTACTGCAGCCTCAACAACGGAATAGGAAACGGGATGGGATTCATTGGAAGGAGACGTGACGACAAACCAGAATGAGACTCTCTCTGTCGAATTGCACAGCACAATATTAGAAATCTGAAAAGTGTCGTTCTTTGTGTAGCTTCGCATGACAAAAGCCATCACGGCCTTAAAGAGATACTCTTCATCTGAGTTCCATGTGTATGCATTGTCGCCCAGAGCTGCTTTGATATTAAGTCGAACTTTAAGTGCTCCGCGAGAACCTGGTCACAGAGATCTCCATGAACAAAAGTGGGTAAAGAGAGAAGAAAGAACAAAATTCCCCCAACATGGTGCCAAACTTTTTTTGACAAAGTTGGCATTTTTAAAAAACAATGCCCTCACCTTTTGTTTTGAAACAAAAAAGGTAAAATA
Full Trace Sequence: GACAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAACGCTGTGTATGCGTCTCCAGTATAATCGTAACTGTCATTCACCAAACTGTCTGTTAATATGGTTTTATCATGAAGGCCGCCATTCTTTATTGCATCCAAAGATTTCATTCTAGCTTCAGAATTTTGACTTTCTTCTTCCGAAGACTTTAATCTTTTTCTGTGCCGTATAACTCCAGATACCACAAGGTAAGCAATCGCAACAGAGACAACAAAAACCACCACCCCAAATACAATAAGCCAGGAGGAACTGGAAGACTGAGAAGCAGGGGCCAATGTGGGTGGAATCTGAACAAACTCCAGAGTTTTGTCATTCAAGAGGAAAGCGCTGTTAATCCGGTTTCTTTCATTTCTTACTGCAGCCTCAACAACGGAATAGGAAACGGGATGGGATTCATTGGAAGGAGACGTGACGACAAACCAGAATGAGACTCTCTCTGTCGAATTGCACAGCACAATATTAGAAATCTGAAAAGTGTCGTTCTTTGTGTAGCTTCGCATGACAAAAGCCATCACGGCCTTAAAGAGATACTCTTCATCTGAGTTCCATGTGTATGCATTGTCGCCCAGAGCTGCTTTGATATTAAGTCGAACTTTAAGTGCTCCGCGAGAACCTGGTCACAGAGATCTCCATGAACAAAAGTGGGTAAAGAGAGAAGAAAGAACAAAATTCCCCCAACATGGTGCCAAACTTTTTTTGACAAAGTTGGCATTTTTAAAAAACAATGCCCTCACCTTTTGTTTTGAAACAAAAAAGGTAAAATA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAACGCTGTGTATGCGTCT