ORFeome > tmem39a ORF2 – XORFeome v1.0

tmem39a ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem39a
Gene ID: 5851800
Gene Page ID: 5851740
ORF Xenbase ID: 17301561

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123181
Original XGC clone length: 1467

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: E11

Sequences - 5ʹ (forward) EST

Accession: JZ838325
dbEST ID: 79656027
Trimmed Sequence: ATGCCCGGTGGAAGGAGGGGTCCAAGCCGGCAGCAACTGAGCCGTTCCGCATTGCCCTCTTTGCAAACCTTGGTTGGTGGGACGTGTGGCAATGGCACAGGGCTGAGGAACAGGAACGGTAGCGCCATTGGCCTCTCGGCTCCTCCCATCACTGCCTTGATTACCCCTGAACCAGTGCGTCACTGCCGCATCCCTGAGCTGCCGGTGGACGGGGGCCTCCTTTTCGAGTTCCTCTTCTTCATCTACCTGCTGGTCGCCCTGTTCATCCAGTACATCAACATCTACAAGTCAGTGTGGTGGTACCCCTACAATCACCCCGCCTCTTGCACCTCACTGAATTTCCATCTGATCGATTACCATTTGGCAGCCTTTATCACGGTCATGCTGGCCCGACGCCTGGTCTGGGCCCTTATATCAAAAGCCTCGCAGGTGGGAACCTCGTCGGTGGTCCATTACACAACTCTGATCATTGGGCGTCTGGTGCTGCTCACACTGTGCGGATGGATCTTCTGCTGGACTCTGGTCAACCTGTTCCGCAATCATTCACTGCTCAACCTCCTCTTCTTGGGCTACCCGTTTGGGGGTTTATGTTCCCCTTTGCTGCTTTCACCAAGACAACCGCTCGCAGCCGCTCCCCTACAAATGTGACTACCTGGTTCCCCAACTCTCTATTCCATAAAAGTGCCAAAGGGCCCCGGGAAGTCGCGTCCGAACCAAAAAATTTCCTCTCCCTTCCTGCCGGAATCCGCTAGAAGGAAGAAGTTTAAAAAACGCCCCCCCCTCGTTCCCCCCCCCCACACCCCGGCCCCCCTTTTCCCCCCCAACC
Full Trace Sequence: CGCGGGCCCATATAATAGATTTTANTTTTGACTGATAGTGACCTGNTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCGGTGGAAGGAGGGGTCCAAGCCGGCAGCAACTGAGCCGTTCCGCATTGCCCTCTTTGCAAACCTTGGTTGGTGGGACGTGTGGCAATGGCACAGGGCTGAGGAACAGGAACGGTAGCGCCATTGGCCTCTCGGCTCCTCCCATCACTGCCTTGATTACCCCTGAACCAGTGCGTCACTGCCGCATCCCTGAGCTGCCGGTGGACGGGGGCCTCCTTTTCGAGTTCCTCTTCTTCATCTACCTGCTGGTCGCCCTGTTCATCCAGTACATCAACATCTACAAGTCAGTGTGGTGGTACCCCTACAATCACCCCGCCTCTTGCACCTCACTGAATTTCCATCTGATCGATTACCATTTGGCAGCCTTTATCACGGTCATGCTGGCCCGACGCCTGGTCTGGGCCCTTATATCAAAAGCCTCGCAGGTGGGAACCTCGTCGGTGGTCCATTACACAACTCTGATCATTGGGCGTCTGGTGCTGCTCACACTGTGCGGATGGATCTTCTGCTGGACTCTGGTCAACCTGTTCCGCAATCATTCACTGCTCAACCTCCTCTTCTTGGGCTACCCGTTTGGGGGTTTATGTTCCCCTTTGCTGCTTTCACCAAGACAACCGCTCGCAGCCGCTCCCCTACAAATGTGACTACCTGGTTCCCCAACTCTCTATTCCATAAAAGTGCCAAAGGGCCCCGGGAAGTCGCGTCCGAACCAAAAAATTTCCTCTCCCTTCCTGCCGGAATCCGCTAGAAGGAAGAAGTTTAAAAAACGCCCCCCCCTCGTTCCCCCCCCCCACACCCCGGCCCCCCTTTTCCCCCCCAACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCGGTGGAAGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838324
dbEST ID: 79656026
Trimmed Sequence: GTGAGGTTTCAGTCCGTAGCTGCTGAAGGGGTAGGAGTAGGCCCGACCCAATACTATCCTGTCCCGGAGGAGCTTGAATAGGACGTAGTAGTTGCAGAAGAGAATGAGCGCAATTGAAAGCGTGTGGTTCCACTTCTCCGCCCGCAGCAGGGAGTAGAGCTGGTAAAGCACCAGGCTGCCCTCGATAACAAGCAGCAGGTTCAGGAGCCGTAACGGCCGGTGAAAGAGAAAATAAAATCTTGCGTGTGAGACTTCTGAAGGCACCGCTACATTATATGGGCCCACAGCTTTGTATAAACTTCTGCTGTGTCGTACCAGAACTCCCTGCGGCCACACTGTATTCTCCGACCAGATGTGTTGGGGTGCGTTGCTGTACGCTCCATGCTCCAACTTCTGCCACTTGCCCAGGTGGGAGGCGGATCTGTGTAACAAGTCACAATACTTTGGGGGGAGGAGCTGGGTGCTGAGCATGACAAAGGCATTGATCCACACCATAATGAGGTGCTCACACGACCAGCGCATGTCGTAATACTGGGTGCTCTTTACCAAGCAGAGCGGCAGGAAGGCCCATAGTAAGCACTGAACAGCCAATTGAAAAAAACTTCCTTGAACCTGCCCGTGAAGTTCGAATTAAAACATTCCACTTCCTTTCCGTAAGAGGGCGGGGGAACAGGGGGGCAGCCTGTGAAACCGGCAAGAAACGGGGGCGCCGTTTTCAATGGGCTCCCCCTCCCCCCATTTCCCCCCCAAGGAAAAGGGAA
Full Trace Sequence: GGCAAACTGCTACTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGAGGTTTCAGTCCGTAGCTGCTGAAGGGGTAGGAGTAGGCCCGACCCAATACTATCCTGTCCCGGAGGAGCTTGAATAGGACGTAGTAGTTGCAGAAGAGAATGAGCGCAATTGAAAGCGTGTGGTTCCACTTCTCCGCCCGCAGCAGGGAGTAGAGCTGGTAAAGCACCAGGCTGCCCTCGATAACAAGCAGCAGGTTCAGGAGCCGTAACGGCCGGTGAAAGAGAAAATAAAATCTTGCGTGTGAGACTTCTGAAGGCACCGCTACATTATATGGGCCCACAGCTTTGTATAAACTTCTGCTGTGTCGTACCAGAACTCCCTGCGGCCACACTGTATTCTCCGACCAGATGTGTTGGGGTGCGTTGCTGTACGCTCCATGCTCCAACTTCTGCCACTTGCCCAGGTGGGAGGCGGATCTGTGTAACAAGTCACAATACTTTGGGGGGAGGAGCTGGGTGCTGAGCATGACAAAGGCATTGATCCACACCATAATGAGGTGCTCACACGACCAGCGCATGTCGTAATACTGGGTGCTCTTTACCAAGCAGAGCGGCAGGAAGGCCCATAGTAAGCACTGAACAGCCAATTGAAAAAAACTTCCTTGAACCTGCCCGTGAAGTTCGAATTAAAACATTCCACTTCCTTTCCGTAAGAGGGCGGGGGAACAGGGGGGCAGCCTGTGAAACCGGCAAGAAACGGGGGCGCCGTTTTCAATGGGCTCCCCCTCCCCCCATTTCCCCCCCAAGGAAAAGGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGAGGTTTCAGTCCGTA