ORFeome > tmem45b ORF1 – XORFeome v1.0

tmem45b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem45b
Gene ID: 5730735
Gene Page ID: 5730662
ORF Xenbase ID: 17301579

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129609
Original XGC clone length: 843

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ837894
dbEST ID: 79655596
Trimmed Sequence: ATGGCAAATTTCAAAGGTCATGCCCTTCCGGGTAGCTTTTTCATTGTCTTTGGCTTATGGTGGTCTGTGAAGTATCCACTTAGATACCTGAACAGCAAGGTAAAAGGAAACTGTAGGTCCAACAAGTGCTATGAACGTTTGGAGCTCATTGAAGGAATACTTAAAGCACTATTTGCATTAATAGGGATGCTGGCAGAGCAATTTGTTCCCGATGGGCCTCATATGCACCTTGTAAATGGAGAGGATCACAGCTGGGTAAAGCTAATGAACTGGCAGCATACAACTATGTACCTCTTTTATGGAATCTCAGGTGTGGTGGATATCCTGACTTATTTTCCCCTAAACGTACCACAGGGATTGGATCGTCTCAGTTTGGGCATGGCTGTCATTGTTGAAGGTCTCCTCTTCTATTATCATGTCCATAATCGGCCAGCACTTGACCAGCACATTCATTCTTTGCTTCTCATTGCTATTTTTGGAGGTGCTATATGTATTATGATAGAAGTGTTTCTGATAAATGATATAATTCTTGAGTTATTCCGTTCCAGTCTCACTATTCTTCACGGAACATGGTTCTGGCGGATTGGGTTAGGGGGTATAGCGACTTCAACGGGGAGCGGGAGTGAACAAGAAGGAACACGGCACGTCCGGGTTTATCCCCAGGGGCTTCTGCTGGGATTAGGCCTTGGCCTTGGCTTATCGTGGCAAAAAGAGAGGGCCTTGGTCCTTTCTTTTTTGTTGGGGAGGGGGGAGAAAGGGTTGTTGGTGAATTTTTTGTAAAAGGGGGGAATACAGAAAAAAAAAAAAAATA
Full Trace Sequence: TCGAGGGCCCACATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAAATTTCAAAGGTCATGCCCTTCCGGGTAGCTTTTTCATTGTCTTTGGCTTATGGTGGTCTGTGAAGTATCCACTTAGATACCTGAACAGCAAGGTAAAAGGAAACTGTAGGTCCAACAAGTGCTATGAACGTTTGGAGCTCATTGAAGGAATACTTAAAGCACTATTTGCATTAATAGGGATGCTGGCAGAGCAATTTGTTCCCGATGGGCCTCATATGCACCTTGTAAATGGAGAGGATCACAGCTGGGTAAAGCTAATGAACTGGCAGCATACAACTATGTACCTCTTTTATGGAATCTCAGGTGTGGTGGATATCCTGACTTATTTTCCCCTAAACGTACCACAGGGATTGGATCGTCTCAGTTTGGGCATGGCTGTCATTGTTGAAGGTCTCCTCTTCTATTATCATGTCCATAATCGGCCAGCACTTGACCAGCACATTCATTCTTTGCTTCTCATTGCTATTTTTGGAGGTGCTATATGTATTATGATAGAAGTGTTTCTGATAAATGATATAATTCTTGAGTTATTCCGTTCCAGTCTCACTATTCTTCACGGAACATGGTTCTGGCGGATTGGGTTAGGGGGTATAGCGACTTCAACGGGGAGCGGGAGTGAACAAGAAGGAACACGGCACGTCCGGGTTTATCCCCAGGGGCTTCTGCTGGGATTAGGCCTTGGCCTTGGCTTATCGTGGCAAAAAGAGAGGGCCTTGGTCCTTTCTTTTTTGTTGGGGAGGGGGGAGAAAGGGTTGTTGGTGAATTTTTTGTAAAAGGGGGGAATACAGAAAAAAAAAAAAAATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAAATTTCAAAGGTCATGC

Sequences - 3ʹ (reverse) EST

Accession: JZ837893
dbEST ID: 79655595
Trimmed Sequence: TTCTTCATCTGAGCCAGCTAGAAGAGAGGCTTCCGCTTCAGCCTTCTTAGAATTTATTTTCCGAATGCCGTTATCCACAATGCCAGACAACTTCTTGTGCCTCTTTACACAACAATAGACCAGAGAATAGTTGATAGCCATGATAAGCAAGGCCACAGCATAATGCCAGCAGAAGCACATGGTGATAAACATGACGTTCCCGTGGTCAGTCTGGTCCCACTCTGGTGCCCCTCCAAGTGGGTATAGCACAAACCCAATCTGCCAGAACCATGTTCCCTGAAGAATAGTGAGACTGGAACGGAATAACTCCAGAATAATATCATTTCTCAGAAACACTTCTATCATAATACATATAGCACCTCCGAAAATAGCAATGAGAAGCAAAGAATGAATGTGCTGGTCAAGTGCTGGCCGATTATGGACATGATAATAGAAGAGGAGACCTTCAACAATGACAGCCATGCCCAAACTGAGACGATCCAATCCCTGTGGTACGTTTAGGGGAAAATAAGTCAGGATATCCACCACACCTGAGATTCCATAAAAGAGGTACGTAGTTGTATGCTGCCAGTTCATTAGCTTTACCCAGCTGTGATCCTCTCCATTTACAAGGTGCATATTAAGGCCCATCGGGAACAAATTGCTCTGCCAGGCATCCCTATTAATGCAAATAGTGCTTTAAGTAATTCCTTCGATGAACTCCGAACGTTTCAAGCACTTGGTGGAGCGGCAGTTCCCTTTTACCCTTGCTGTCGGGTATCCTAGTTGATACGTTACAGAACAACATAAAGCCAAAAACATGGAAAAGCTACCCCGAAGGGGAGGAGGTTGAAAATTGCGCATGGTGCCGACTGTTTTTGTACGGATTTGGCATTAAAAAGAGAACAATGCCTCATCAGTGGGTGCCAACGAAGGAGGGCACTAACCGGGAAAAAAGAAAAAAAAAAAAAAAAAAAACACAAAACTAAAAAAAGGGCGGCTGGTTGTAAGAAAACACGGAGGAAGGAGGGGAAATGAGGAGGGCGCTCGAGTAGGAGGAATAATGGGGAGGNGGGGGAGGAGGAAGCACAAAGGAAAAAGAAGGAGGGGAGAGGAGGAGCGGGGGGGGGAGGAAGGAGAGGGGGGGGTTAAGGGGCGGGTGGGAGGTGAGAGGGAGAAAGCGGGAGAAGAAGGNAAGGAGGGAGGAAAAGTAGAGGGGGAGAAAAAGGAGAGAGGAGGGGAGGAGGGGGGGAAGAGAGA
Full Trace Sequence: GGGGCAGGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCTTCATCTGAGCCAGCTAGAAGAGAGGCTTCCGCTTCAGCCTTCTTAGAATTTATTTTCCGAATGCCGTTATCCACAATGCCAGACAACTTCTTGTGCCTCTTTACACAACAATAGACCAGAGAATAGTTGATAGCCATGATAAGCAAGGCCACAGCATAATGCCAGCAGAAGCACATGGTGATAAACATGACGTTCCCGTGGTCAGTCTGGTCCCACTCTGGTGCCCCTCCAAGTGGGTATAGCACAAACCCAATCTGCCAGAACCATGTTCCCTGAAGAATAGTGAGACTGGAACGGAATAACTCCAGAATAATATCATTTCTCAGAAACACTTCTATCATAATACATATAGCACCTCCGAAAATAGCAATGAGAAGCAAAGAATGAATGTGCTGGTCAAGTGCTGGCCGATTATGGACATGATAATAGAAGAGGAGACCTTCAACAATGACAGCCATGCCCAAACTGAGACGATCCAATCCCTGTGGTACGTTTAGGGGAAAATAAGTCAGGATATCCACCACACCTGAGATTCCATAAAAGAGGTACGTAGTTGTATGCTGCCAGTTCATTAGCTTTACCCAGCTGTGATCCTCTCCATTTACAAGGTGCATATTAAGGCCCATCGGGAACAAATTGCTCTGCCAGGCATCCCTATTAATGCAAATAGTGCTTTAAGTAATTCCTTCGATGAACTCCGAACGTTTCAAGCACTTGGTGGAGCGGCAGTTCCCTTTTACCCTTGCTGTCGGGTATCCTAGTTGATACGTTACAGAACAACATAAAGCCAAAAACATGGAAAAGCTACCCCGAAGGGGAGGAGGTTGAAAATTGCGCATGGTGCCGACTGTTTTTGTACGGATTTGGCATTAAAAAGAGAACAATGCCTCATCAGTGGGTGCCAACGAAGGAGGGCACTAACCGGGAAAAAAGAAAAAAAAAAAAAAAAAAAACACAAAACTAAAAAAAGGGCGGCTGGTTGTAAGAAAACACGGAGGAAGGAGGGGAAATGAGGAGGGCGCTCGAGTAGGAGGAATAATGGGGAGGNGGGGGAGGAGGAAGCACAAAGGAAAAAGAAGGAGGGGAGAGGAGGAGCGGGGGGGGGAGGAAGGAGAGGGGGGGGTTAAGGGGCGGGTGGGAGGTGAGAGGGAGAAAGCGGGAGAAGAAGGNAAGGAGGGAGGAAAAGTAGAGGGGGAGAAAAAGGAGAGAGGAGGGGAGGAGGGGGGGAAGAGAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTTCATCTGAGCCAGCTA