ORFeome > tmem56 ORF1 – XORFeome v1.0

tmem56 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tmem56
Gene ID: 5813226
Gene Page ID: 5813219
ORF Xenbase ID: 17301639

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056848
Original XGC clone length: 789

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ839451
dbEST ID: 79657153
Trimmed Sequence: ATGGCTAACTTCAGCCCTCTGACTGTCTTTATCTCAGTGACTAGCTTAGCAGTATTTCAGTTCCTGTTTCATGTTGGAAGCTCCTGGCTCTCCACCCGTTTAACTGGTGGTTTCCACAAGCTGAGTGCAAGGCAGAAGATTGAATGGAATTCCAGGACGGTGTCCTCATTCCATGCTTTGGTGGTTGGATGTTTCTGCTTGTATATTTTGGTGTACGATGATGCTGTTAATGCTGACCCTGTTTGGGGTGATCCCTTCATGGTCAAGCTGAATGTTGCAGTAACCTCAGGCTACCTCATTTCAGACCTGTTGCTTATTATTTATTACTGGAAGGAGATTGGTGATAAATATTTTGTGACACATCACTTGGCAGCTCTGTATGCTTGCTACTATGTACTGGGTGAAGGAATGTTGCCATATTTTGGTAATTTCCGACTAATTGCTGAATTTTCTACACCCTTTGTTAATCAACGGTGGTTTTTCGAAGTTTTGGGATATTCCAAATATTCTCTCCCAAACATGGTAAATGGTGTTCTGATGACAATCTCCTTCTTCATTGTGAGAATAGCGGTCATACCGATCTATTATGGGCGTGTCTTTTCCACCTTCGGCACGGAGGCGTTTCACAGACTGGGACTTGGTGCCCAGTGCGCATGGATCATCTCAGGTGTATCACTGGATATTATGAACGTTATGTGGATGATAAAAATTGCAAAAAGGGTGCTACAAAGTCCTCTTACACAAAAGATGGGAAATTTTAACAAAACCCAGAAAAAATGAAAAAACTAAAGATTGCCC
Full Trace Sequence: TCGCGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTAACTTCAGCCCTCTGACTGTCTTTATCTCAGTGACTAGCTTAGCAGTATTTCAGTTCCTGTTTCATGTTGGAAGCTCCTGGCTCTCCACCCGTTTAACTGGTGGTTTCCACAAGCTGAGTGCAAGGCAGAAGATTGAATGGAATTCCAGGACGGTGTCCTCATTCCATGCTTTGGTGGTTGGATGTTTCTGCTTGTATATTTTGGTGTACGATGATGCTGTTAATGCTGACCCTGTTTGGGGTGATCCCTTCATGGTCAAGCTGAATGTTGCAGTAACCTCAGGCTACCTCATTTCAGACCTGTTGCTTATTATTTATTACTGGAAGGAGATTGGTGATAAATATTTTGTGACACATCACTTGGCAGCTCTGTATGCTTGCTACTATGTACTGGGTGAAGGAATGTTGCCATATTTTGGTAATTTCCGACTAATTGCTGAATTTTCTACACCCTTTGTTAATCAACGGTGGTTTTTCGAAGTTTTGGGATATTCCAAATATTCTCTCCCAAACATGGTAAATGGTGTTCTGATGACAATCTCCTTCTTCATTGTGAGAATAGCGGTCATACCGATCTATTATGGGCGTGTCTTTTCCACCTTCGGCACGGAGGCGTTTCACAGACTGGGACTTGGTGCCCAGTGCGCATGGATCATCTCAGGTGTATCACTGGATATTATGAACGTTATGTGGATGATAAAAATTGCAAAAAGGGTGCTACAAAGTCCTCTTACACAAAAGATGGGAAATTTTAACAAAACCCAGAAAAAATGAAAAAACTAAAGATTGCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTAACTTCAGCCCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ839450
dbEST ID: 79657152
Trimmed Sequence: CTCTAGTTTTCCATTATTCTGTGTTTTGGTCAATTTCCCATCTCTGTGATAGAGGACTTTGTAGCACCCTTTTGCAATTTTTATCATCCACATAACGTTCATAATATCCAGTGATACACTTGAGATGATCCATGCGCACTGGGCACCAAGTCCCAGTCTGTGAAACGCCTCCGTGCCGAAGGTGGAAAAGACACGCCCATAATAGATCGGTATGACCGCTATTCTCACAATGAAGAAGGAGATTGTCATCAGAACACCATTTACCATGTTTGGGAGAGAATATTTGGAATATCCCAAAACTTCGAAAAACCACCGTTGATTAACAAAGGGTGTAGAAAATTCAGCAATTAGTCGGAAATTACCAAAATATGGCAACATTCCTTCACCCAGTACATAGTAGCAAGCATACAGAGCTGCCAAGTGATGTGTCACAAAATATTTATCACCAATCTCCTTCCAGTAATAAATAATAAGCAACAGGTCTGAAATGAGGTAGCCTGAGGTTACTGCAACATTCAGCTTGACCATGAAAGGATCACCCCAAACAGGGTCAGCATTAACAGCATCATCGTACACCAAAATATACAAGCAGAAACATCCAACCACCAAAACATGGGAATGAGGACACCGTCCTGGAATTTCCGTTCCATCTTTCTGCCTTGCACTCCACCTGGGGGAAAACCCCCCGGTTAAACGGGGTGGGAAAACCCGGGAACCTCCCCCCAATGAAAAAAGGAAACTTGAAAAAAAATGGCTTTAAACCCAAAGT
Full Trace Sequence: AAACGTCTATTGAACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCTAGTTTTCCATTATTCTGTGTTTTGGTCAATTTCCCATCTCTGTGATAGAGGACTTTGTAGCACCCTTTTGCAATTTTTATCATCCACATAACGTTCATAATATCCAGTGATACACTTGAGATGATCCATGCGCACTGGGCACCAAGTCCCAGTCTGTGAAACGCCTCCGTGCCGAAGGTGGAAAAGACACGCCCATAATAGATCGGTATGACCGCTATTCTCACAATGAAGAAGGAGATTGTCATCAGAACACCATTTACCATGTTTGGGAGAGAATATTTGGAATATCCCAAAACTTCGAAAAACCACCGTTGATTAACAAAGGGTGTAGAAAATTCAGCAATTAGTCGGAAATTACCAAAATATGGCAACATTCCTTCACCCAGTACATAGTAGCAAGCATACAGAGCTGCCAAGTGATGTGTCACAAAATATTTATCACCAATCTCCTTCCAGTAATAAATAATAAGCAACAGGTCTGAAATGAGGTAGCCTGAGGTTACTGCAACATTCAGCTTGACCATGAAAGGATCACCCCAAACAGGGTCAGCATTAACAGCATCATCGTACACCAAAATATACAAGCAGAAACATCCAACCACCAAAACATGGGAATGAGGACACCGTCCTGGAATTTCCGTTCCATCTTTCTGCCTTGCACTCCACCTGGGGGAAAACCCCCCGGTTAAACGGGGTGGGAAAACCCGGGAACCTCCCCCCAATGAAAAAAGGAAACTTGAAAAAAAATGGCTTTAAACCCAAAGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTAGTTTTCCATTATTCTGTGT