ORFeome > tmem62 ORF1 – XORFeome v1.0

tmem62 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem62
Gene ID: 6252457
Gene Page ID: 979534
ORF Xenbase ID: 17301663

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC126052
Original XGC clone length: 1851

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ837786
dbEST ID: 79655488
Trimmed Sequence: ATGCTGAAGTTGGTAGGTGGTTTGTTACTTGCTGGGCTGCTGACACACATACTCGGCTGGTATAGTACAATCGGAAGTCGGGCTCGATTACAGCGGCGCCATTTCGTTAATGACAGAGGACCTGTGCTTGGATCAGAGCTCAGCAATCTCTTCTGGGCTGTGCAGGTGACTGATATCCATGTGTCTAAATTTCTGGATCCCTTAAGAGTCACAGAGTTTGAAGCCTTCTGCATGGAAAGCCTCCCTGTCATCAATCCTGCTCTGGTTCTAGCCACAGGTGACCTCACTGATGCCAAGACCAAGGATAGACTGGGCTCAGACCAGTTTGAGGACGAGTGGAAGGTTTACCAATCTGTATTGAAGAAGTCAGGGATATTGAAAAGAACAAAATGGATCGATATAAGGGGGAACCATGATTCATTTAACATTCCAGACTTGAGAAGCATCAAGAATTTCTACAGGAAATATTCAGCATGGCAAAAAGAAGGTTCCTTTCATTATGTCCACGATACTCCCTTCGGAGACTACTCCTTCATTTGTATTGATGCTACGCTCACTCCAGGCCCTAAGCGGCCTTATGACTTCTTTGGTATCATAGATAAGGAACAAATGCACACACTTTCCAGACTGGCTATAGAGAGCCACTACAGCAACCCAACCAGTGTGGTTTGGCCCCCTATCCCACTTCCACCAATTGTCTCTGTTTCTCCCTG
Full Trace Sequence: CCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGAAGTTGGTAGGTGGTTTGTTACTTGCTGGGCTGCTGACACACATACTCGGCTGGTATAGTACAATCGGAAGTCGGGCTCGATTACAGCGGCGCCATTTCGTTAATGACAGAGGACCTGTGCTTGGATCAGAGCTCAGCAATCTCTTCTGGGCTGTGCAGGTGACTGATATCCATGTGTCTAAATTTCTGGATCCCTTAAGAGTCACAGAGTTTGAAGCCTTCTGCATGGAAAGCCTCCCTGTCATCAATCCTGCTCTGGTTCTAGCCACAGGTGACCTCACTGATGCCAAGACCAAGGATAGACTGGGCTCAGACCAGTTTGAGGACGAGTGGAAGGTTTACCAATCTGTATTGAAGAAGTCAGGGATATTGAAAAGAACAAAATGGATCGATATAAGGGGGAACCATGATTCATTTAACATTCCAGACTTGAGAAGCATCAAGAATTTCTACAGGAAATATTCAGCATGGCAAAAAGAAGGTTCCTTTCATTATGTCCACGATACTCCCTTCGGAGACTACTCCTTCATTTGTATTGATGCTACGCTCACTCCAGGCCCTAAGCGGCCTTATGACTTCTTTGGTATCATAGATAAGGAACAAATGCACACACTTTCCAGACTGGCTATAGAGAGCCACTACAGCAACCCAACCAGTGTGGTTTGGCCCCCTATCCCACTTCCACCAATTGTCTCTGTTTCTCCCTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGAAGTTGGTAGGTGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837785
dbEST ID: 79655487
Trimmed Sequence: AAAGCGCAAACAGATTCCTTCACATTCAATCCCGAAATCTGACATGGGAGAGAGGAAGGCTGCTAAAGTCCCGTAGGTCATTGCCAGGAAGATGCAGGAATACACTTGCCATGCGAAAATCAGGATGACAAATAGATAGACGGGGAGGCACACGATTTTCCTGCTGTGTCGGAAATGGGAGCAGAATCCATGGCCTTTGCATCGGAGAAATAGGCACCAGCACAGATAAGCCGTCATAGGAACGTTAAAAAATACCATCTGTGTTATTGCAACAAAGTAAGTCAGGCTTCCTTGAACGAAATTCCCACCAACAATGACTCCAAAGGCAAAGCACACTCCAATATGGCCGTCAATAATCTCACCAACAAACCAGGGGCCCACTGCTGTGTAAATGCTGAGCAGCAGGACGGAGTAGAAGAAAAGATTGGTTTTGCTCAGCACATGCATAGAGAAGGATGTCAGAGCAATGAATCCTTGAGGGCCCCTAAGAATTGGCCGTCTCTTGTATCTGAAAATAATTAGCAGGATGATCTGGCTCAGCACCGAGAGGAAAAACAGCACTTGTGCCAATATGTAGTGGTCGGTAAGAAGAATTAAAGATGGAATCAAAGGAAAGCCAAGAGATATGCCATCTTCTAGACTGAACAAATGGCTTCTTGTTTGGCTTCTTCCGTCTGCATCCTGGACCACGACGCTGATCTCATGAATCCCAGTCTGGTAGTTATCAAGGTTCCATTTTAAGGTGTAGAAAGGGCCAGATGATAGGGGAACTTCGCCCAGCTCAGAACCATCTATTGAAACACGGACTGAAAGTGAAAAAACTTGGTGGAAAAATGTCAGGATCCTGAATATGAGTGGAAAGCAAAACCCTCCTTGGTAGTTCCCGAAGCAAGGGTTGGAATTAAAAAGCAAAAACTTGGAATTAATAAATAAAGAATTTCGGGGCCAAACCATTTGTAAAACTAAAACCCCCAAAACCTGAAAAAAGTTCATGGGTGCAAAGGCCGGAGAAAGCGAAAATTCTTTTCTAATTTATTCCTTCCCCTTTCCCCCCAACCTCCTCCCACCCTCAAAAGGGGTGCCCCCCTGGCTGGTTGTGCGGGAAAAATGTGGGGGAGGAAAAAAAAGAGGGGGAACAAATAGAAACCCCTCTCACAAACAAAAAAAG
Full Trace Sequence: GGGCGAGAATACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAGCGCAAACAGATTCCTTCACATTCAATCCCGAAATCTGACATGGGAGAGAGGAAGGCTGCTAAAGTCCCGTAGGTCATTGCCAGGAAGATGCAGGAATACACTTGCCATGCGAAAATCAGGATGACAAATAGATAGACGGGGAGGCACACGATTTTCCTGCTGTGTCGGAAATGGGAGCAGAATCCATGGCCTTTGCATCGGAGAAATAGGCACCAGCACAGATAAGCCGTCATAGGAACGTTAAAAAATACCATCTGTGTTATTGCAACAAAGTAAGTCAGGCTTCCTTGAACGAAATTCCCACCAACAATGACTCCAAAGGCAAAGCACACTCCAATATGGCCGTCAATAATCTCACCAACAAACCAGGGGCCCACTGCTGTGTAAATGCTGAGCAGCAGGACGGAGTAGAAGAAAAGATTGGTTTTGCTCAGCACATGCATAGAGAAGGATGTCAGAGCAATGAATCCTTGAGGGCCCCTAAGAATTGGCCGTCTCTTGTATCTGAAAATAATTAGCAGGATGATCTGGCTCAGCACCGAGAGGAAAAACAGCACTTGTGCCAATATGTAGTGGTCGGTAAGAAGAATTAAAGATGGAATCAAAGGAAAGCCAAGAGATATGCCATCTTCTAGACTGAACAAATGGCTTCTTGTTTGGCTTCTTCCGTCTGCATCCTGGACCACGACGCTGATCTCATGAATCCCAGTCTGGTAGTTATCAAGGTTCCATTTTAAGGTGTAGAAAGGGCCAGATGATAGGGGAACTTCGCCCAGCTCAGAACCATCTATTGAAACACGGACTGAAAGTGAAAAAACTTGGTGGAAAAATGTCAGGATCCTGAATATGAGTGGAAAGCAAAACCCTCCTTGGTAGTTCCCGAAGCAAGGGTTGGAATTAAAAAGCAAAAACTTGGAATTAATAAATAAAGAATTTCGGGGCCAAACCATTTGTAAAACTAAAACCCCCAAAACCTGAAAAAAGTTCATGGGTGCAAAGGCCGGAGAAAGCGAAAATTCTTTTCTAATTTATTCCTTCCCCTTTCCCCCCAACCTCCTCCCACCCTCAAAAGGGGTGCCCCCCTGGCTGGTTGTGCGGGAAAAATGTGGGGGAGGAAAAAAAAGAGGGGGAACAAATAGAAACCCCTCTCACAAACAAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAGCGCAAACAGATTCCTTCA