ORFeome > tmem66 ORF1 – XORFeome v1.0

tmem66 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem66
Gene ID: 997093
Gene Page ID: 997089
ORF Xenbase ID: 17301675

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC123170
Original XGC clone length: 903

Human orthology & disease relationships

NCBI Entrez ID: 51669
Ensembl gene IDs: ENSG00000133872
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 270200,604232,607765,608643,609924

Library Location

Plate ID: GDExl11088
Well Location: D04

Sequences - 5ʹ (forward) EST

Accession: JZ838159
dbEST ID: 79655861
Trimmed Sequence: ATGTGGACACTACTTCTATTGCCTTTTTTCGCCATGCTTCAGGTCCATTATGCTTGGTGTTGGAGTCCTCAAGATAGAGTACTTTTGAGGGATATTCAGACAATTACTCTGTATGCTGACCGATATACCAATGCCCGCCGCTCCGCTCCTGTGCCACAACTGAAGTGTATTGGTGGGAACGCAGGCTGTCATGCAATGGTGCCACAGGTAGTACAGTGTCACAACCGAGGATGGGATGGCTTGGATGTTCAGTGGGAATGCAGAGTGGACATGGACAATTCATATCGATTTGGTAAAGTGGAAGTAAGCTGCGAAGGCTTTGACTTCCCAGAAGATCCATATGTTCTCCGTGGCTCCTGTGGGTTAGAGTATACTCTTGAGCTCACAGAGGAAGGCAGAAAGAGAACACAAGATGGGTACAGAAGTGCTGGCTTTGGCTCAGGCTATTTCCAAAGCAATTCACAAAGCTGGGATTCCGAAACAGATGGCAGCAGTGCAATTGTTCTCATATTTATAATCATACTTGCTTAATGGAGTGTAGAAGCTATTCCTGATTCGCCCATCGGTGCCGCCACACCCTCAACCTTATGAATATGGATATGGATCGCAGAAACCAAACTCATTCTAAAGCTTCCTCGCCCGCCTTCAAGTCGGAATTCACAAGCAATTCCAAGAGGTTTTTTTACCGGGCATGGGAATAAGGGAACATAAAGTGGGAAGGGGGGGTTAAACAAAAAGGTTAAATGAGAGGGGGGAGGAGGGGCA
Full Trace Sequence: GCCCCAAATAATAGATTTTATTTCTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGACACTACTTCTATTGCCTTTTTTCGCCATGCTTCAGGTCCATTATGCTTGGTGTTGGAGTCCTCAAGATAGAGTACTTTTGAGGGATATTCAGACAATTACTCTGTATGCTGACCGATATACCAATGCCCGCCGCTCCGCTCCTGTGCCACAACTGAAGTGTATTGGTGGGAACGCAGGCTGTCATGCAATGGTGCCACAGGTAGTACAGTGTCACAACCGAGGATGGGATGGCTTGGATGTTCAGTGGGAATGCAGAGTGGACATGGACAATTCATATCGATTTGGTAAAGTGGAAGTAAGCTGCGAAGGCTTTGACTTCCCAGAAGATCCATATGTTCTCCGTGGCTCCTGTGGGTTAGAGTATACTCTTGAGCTCACAGAGGAAGGCAGAAAGAGAACACAAGATGGGTACAGAAGTGCTGGCTTTGGCTCAGGCTATTTCCAAAGCAATTCACAAAGCTGGGATTCCGAAACAGATGGCAGCAGTGCAATTGTTCTCATATTTATAATCATACTTGCTTAATGGAGTGTAGAAGCTATTCCTGATTCGCCCATCGGTGCCGCCACACCCTCAACCTTATGAATATGGATATGGATCGCAGAAACCAAACTCATTCTAAAGCTTCCTCGCCCGCCTTCAAGTCGGAATTCACAAGCAATTCCAAGAGGTTTTTTTACCGGGCATGGGAATAAGGGAACATAAAGTGGGAAGGGGGGGTTAAACAAAAAGGTTAAATGAGAGGGGGGAGGAGGGGCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGACACTACTTCTATTGCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838158
dbEST ID: 79655860
Trimmed Sequence: TCTTCTTTTGGTTCCTCCAAATCCTGAAGCTGTCCGGACACCTGAGCTCTGTGGTGGCCTGTCATTTTGATGCATTGATTCTGAATGGGAAGGACCAGTCCAAGTGTTGAAGTATGGTGACTGGTATGGCTGAGCTCTTCGGTTACCAAATAGGTATCCCAATACACCTCCTGTTCCAAGACCTGTCCAAAACCCAGGTCCCTGATTCACATGACCGGTACCATAACCTGAGGAAAAGCCTGTGAAGTCTGACTTGAAGCCAGGTGGAGGAGCACTAGAATGAGTCTGGCTTTGATGATCATATCCATACTCATCAGGTCGAGGGTGTTGCTGCACTGATGGGCCACTCAGGAATAGCTTGTACACTCCATAAGCAAGTATGACTATAAATATGAGAACAATTGCACTGCTGCCATCTGTTTTGGAATCCCAGCTTTGTGAATTGCTTTGGAAATAGCCTGAGCCAAAGCCAGCACTTCTGTACCCATCTTGTGTTCTCTTTCTGCCTTCCTCTGTGAGCTCAGGAGTATACTCTAACCCACAGGAGCCACGGAAAACATATGGAACTTTCGGGGAAGTCAGAGCCTTTCCAACTTACTTCCATTTTACCAATCCAATTAAATTGGTCATGTCCACATCTGCATTCGCCCTGGAAGAATCCGGCCATTCCCATCCTCGGGGTGGGAACCTGGAAATTACCTTGTGGCACCTTTGGGTGTGAACCCCTGCGCTATCCCCCACCAAAAACGCGTTCCAATTTTTTTTCGCA
Full Trace Sequence: GCGAAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTTCTTTTGGTTCCTCCAAATCCTGAAGCTGTCCGGACACCTGAGCTCTGTGGTGGCCTGTCATTTTGATGCATTGATTCTGAATGGGAAGGACCAGTCCAAGTGTTGAAGTATGGTGACTGGTATGGCTGAGCTCTTCGGTTACCAAATAGGTATCCCAATACACCTCCTGTTCCAAGACCTGTCCAAAACCCAGGTCCCTGATTCACATGACCGGTACCATAACCTGAGGAAAAGCCTGTGAAGTCTGACTTGAAGCCAGGTGGAGGAGCACTAGAATGAGTCTGGCTTTGATGATCATATCCATACTCATCAGGTCGAGGGTGTTGCTGCACTGATGGGCCACTCAGGAATAGCTTGTACACTCCATAAGCAAGTATGACTATAAATATGAGAACAATTGCACTGCTGCCATCTGTTTTGGAATCCCAGCTTTGTGAATTGCTTTGGAAATAGCCTGAGCCAAAGCCAGCACTTCTGTACCCATCTTGTGTTCTCTTTCTGCCTTCCTCTGTGAGCTCAGGAGTATACTCTAACCCACAGGAGCCACGGAAAACATATGGAACTTTCGGGGAAGTCAGAGCCTTTCCAACTTACTTCCATTTTACCAATCCAATTAAATTGGTCATGTCCACATCTGCATTCGCCCTGGAAGAATCCGGCCATTCCCATCCTCGGGGTGGGAACCTGGAAATTACCTTGTGGCACCTTTGGGTGTGAACCCCTGCGCTATCCCCCACCAAAAACGCGTTCCAATTTTTTTTCGCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTTCTTTTGGTTCCTCCAAATC