ORFeome > tmem86a ORF1 – XORFeome v1.0

tmem86a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem86a
Gene ID: 6252443
Gene Page ID: 1007199
ORF Xenbase ID: 17301693

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123165
Original XGC clone length: 714

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: E07

Sequences - 5ʹ (forward) EST

Accession: JZ838077
dbEST ID: 79655779
Trimmed Sequence: ATGGTGTCTCCAGTTACTGTGGTGAAAAGTGAAGGACCAAAGCTGGTGCCATTTTTCAAGGCCACTTGTGTGTATTTTGTCCTGTGGCTTCCGACCTCCAGCCCGTCCTGGTTCAGTGCCCTCATTAAGTGCTTGCCCATCTTCTGCCTGTGGGTGTTTCTCCTGGCCCACGGGCTGAATTTCCTGGTCACTCGTCGATGTGCCAAAAGGATTTTTGTGGGACTGATCTTCTCGGCTGTGGGTGACGCCTTCCTCATCTGGCAGGAACAGGGTTACTTTGTGCACGGGCTGCTCATGTTTGCCATCACCCACATCCTTTACTCGTCAGCATTTGGGATGAAACCACTGGACCTGCGCACTGGGATAGTCATAGGACTGATTTCTGGGGGTCTCTACACGTTCCTGTACACCTACCTCTCGGGCCCCTTCACCTACCTGGTTGCCGTCTACACTGCTCTCATTGCCTTCATGGGCTGGAGGGCCGTCGCTGGGGTGCAGCTCTGGAACGACCTCTGGACCTGGACCAAACTCTCCGCCTGTATCGGTTCCGTCCTCTTCATCGTGTCCGACCTGACCATCGCCGTCAACAAGTTCTGCTTCCCGGTGCCGTGCTCTCGGGCCATCATCATGGCTACCTACTACGCGGCCCAGATGCTCATTGCCCTGTCAGCGGTTGAGTGCCGGGATGAGGATGGCTACAGGGAAGAGGAAGTTTGCAACTTTCTTGTACAAAGTTGGCAATATTAA
Full Trace Sequence: CTTGGTTCGAGCGCACAGATATATTTAGATTATTCTTAGACTGATACACACCTGTCTCGCTCGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGTCTCCAGTTACTGTGGTGAAAAGTGAAGGACCAAAGCTGGTGCCATTTTTCAAGGCCACTTGTGTGTATTTTGTCCTGTGGCTTCCGACCTCCAGCCCGTCCTGGTTCAGTGCCCTCATTAAGTGCTTGCCCATCTTCTGCCTGTGGGTGTTTCTCCTGGCCCACGGGCTGAATTTCCTGGTCACTCGTCGATGTGCCAAAAGGATTTTTGTGGGACTGATCTTCTCGGCTGTGGGTGACGCCTTCCTCATCTGGCAGGAACAGGGTTACTTTGTGCACGGGCTGCTCATGTTTGCCATCACCCACATCCTTTACTCGTCAGCATTTGGGATGAAACCACTGGACCTGCGCACTGGGATAGTCATAGGACTGATTTCTGGGGGTCTCTACACGTTCCTGTACACCTACCTCTCGGGCCCCTTCACCTACCTGGTTGCCGTCTACACTGCTCTCATTGCCTTCATGGGCTGGAGGGCCGTCGCTGGGGTGCAGCTCTGGAACGACCTCTGGACCTGGACCAAACTCTCCGCCTGTATCGGTTCCGTCCTCTTCATCGTGTCCGACCTGACCATCGCCGTCAACAAGTTCTGCTTCCCGGTGCCGTGCTCTCGGGCCATCATCATGGCTACCTACTACGCGGCCCAGATGCTCATTGCCCTGTCAGCGGTTGAGTGCCGGGATGAGGATGGCTACAGGGAAGAGGAAGTTTGCAACTTTCTTGTACAAAGTTGGCAATATTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGTCTCCAGTTACTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838076
dbEST ID: 79655778
Trimmed Sequence: CTTCCTCTTCCTGTAGCCATCCTCATCCCGGCACTCAACCGCTGACAGGGCAATGAGCATCTGGGCCGCGTAGTAGGTAGCCATGATGATGGCCCGAGAGCACGGCACCGGGAAGCAGAACTTGTTGACGGCGATGGTCAGGTCGGACACGATGAAGAGGACGGAACCGATACAGGCGGAGAGTTTGGTCCAGGTCCAGAGGTCGTTCCAGAGCTGCACCCCAGCGACGGCCCTCCAGCCCATGAAGGCAATGAGAGCAGTGTAGACGGCAACCAGGTAGGTGAAGGGGCCCGAGAGGTAGGTGTACAGGAACGTGTAGAGACCCCCAGAAATCAGTCCTATGACTATCCCAGTGCGCAGGTCCAGTGGTTTCATCCCAAATGCTGACGAGTAAAGGATGTGGGTGATGGCAAACATGAGCAGCCCGTGCACAAAGTAACCCTGTTCCTGCCAGATGAGGAAGGCGTCACCCACAGCCGAGAAGATCAGTCCCACAAAAATCCTTTTGGCACATCGACGAGTGACCAGGAAATTCAGCCCGTGGGCCAGGAGAAACACCCACAGGCAGAAGATGGGCAAGCACTTAATGAGGGCACTGAACCAGGAACGGCTGGAGGTCCGAAGCCCAAGGACAAAAACACAACAAGTGGCCTTGAAAAATGGCACCAGCTTTGGGTCCCTTCACTTTTTCACCACATTAACTGGAAGAACCCAGGGTTGGCCAACTTTTTTTTGTTCAAAAGTTTTGCGAATTATTAA
Full Trace Sequence: GGGTAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCCTCTTCCTGTAGCCATCCTCATCCCGGCACTCAACCGCTGACAGGGCAATGAGCATCTGGGCCGCGTAGTAGGTAGCCATGATGATGGCCCGAGAGCACGGCACCGGGAAGCAGAACTTGTTGACGGCGATGGTCAGGTCGGACACGATGAAGAGGACGGAACCGATACAGGCGGAGAGTTTGGTCCAGGTCCAGAGGTCGTTCCAGAGCTGCACCCCAGCGACGGCCCTCCAGCCCATGAAGGCAATGAGAGCAGTGTAGACGGCAACCAGGTAGGTGAAGGGGCCCGAGAGGTAGGTGTACAGGAACGTGTAGAGACCCCCAGAAATCAGTCCTATGACTATCCCAGTGCGCAGGTCCAGTGGTTTCATCCCAAATGCTGACGAGTAAAGGATGTGGGTGATGGCAAACATGAGCAGCCCGTGCACAAAGTAACCCTGTTCCTGCCAGATGAGGAAGGCGTCACCCACAGCCGAGAAGATCAGTCCCACAAAAATCCTTTTGGCACATCGACGAGTGACCAGGAAATTCAGCCCGTGGGCCAGGAGAAACACCCACAGGCAGAAGATGGGCAAGCACTTAATGAGGGCACTGAACCAGGAACGGCTGGAGGTCCGAAGCCCAAGGACAAAAACACAACAAGTGGCCTTGAAAAATGGCACCAGCTTTGGGTCCCTTCACTTTTTCACCACATTAACTGGAAGAACCCAGGGTTGGCCAACTTTTTTTTGTTCAAAAGTTTTGCGAATTATTAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCCTCTTCCTGTAGCC