ORFeome > tmf1 ORF1 – XORFeome v1.0

tmf1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmf1
Gene ID: 958633
Gene Page ID: 958627
ORF Xenbase ID: 17301705

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129629
Original XGC clone length: 3279

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ837795
dbEST ID: 79655497
Trimmed Sequence: ATGAGCTGGTTCAACACCATTCTGCAGATGTACGGAGAGAAGGCTGAGGAGGCAGAGGAACTGAGACTCGATCTGGAAGATGTAAAAAACATGTACAAGATGCAAATAGACGAACTATTGCAGCAGAGACTCCATTT
Full Trace Sequence: GGGGTCTAGGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCTGGTTCAACACCATTCTGCAGATGTACGGAGAGAAGGCTGAGGAGGCAGAGGAACTGAGACTCGATCTGGAAGATGTAAAAAACATGTACAAGATGCAAATAGACGAACTATTGCAGCAGAGACTCCATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAATAAAACAAAAAAAAAAACATTAAACGGGATTATGGAATCGCAGGGGGCCGAGAAGGAGACAGGCCAGGTCTGAAAAGGGTCGCAGGTGGTTGCTAGCCGGGGTTGCGGGGAGACGCCCAGCGCGGGAACAAATGCCGGGCCGGGCCTTAGTGGAAATGAACCTGCGCCGGGCGCAGCCCCCAGGGCCAAAACCTTAACCCGCCCACCCGTGGGGGCCGGGAACCGGGCGTTTTCGGGGTTGGGGGTAATGGTTTCTTGGGGGGTTTTCATGGCCTGGTGACCACAGGTTTTAGTGGGGAAACCGGGGGGGGCCCTGTGGGGATTATAGGAGAAAAACCAGATTTACCCCCGGGGGGAGAGGCGTTCGAAAGATTATTGAAAACATTAAGGAGGAAGGGGGGGGAGCCAGGGGAGATTTATCCCCCCTCTACCACCAAGACGTTTAGCGGTATGTGTTTGGGGTGCGACCCCCCGGCAGACAAGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCTGGTTCAACACCT

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GTGGCGGGGAAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTNACTNATANTNACCTNTTCNTTNCNNCNNATTNATAANCAATNCTTTCTTATAATTCCAACTTTNTACAAAAAANTTNACAAATNNANTCTCTNCTNCAATANTTCNTCTATTTNCATCTTNTACATNTTTTTTACATCTTCCAAATCTANTCTCANTTCCTCTTCCTCCTCATCCTTCTCTCCNTACATCTNCATAATTATATTTAACCATCTCATAATACCAACTTTTTTATACAAAATTCTCATTATAAAAAANCATTCCTCATCAATTTTTTCCAACAAACACATCACTATCATTCAAAATAAAATCATTATTTTATATCCAACCTTAATACTCTCTCNTCCTTTTAAAATAACAAAAACAAAACAAAAAAAATCCTACTCCTACCCCCCCCTCAAACAAATAAACTACAATCCATCTAAATACAACAACCCCTTCATACACAAAAATTTNCTCCTTCAAAAAACCCCTAAAAACACAAAAAAACCCTCTCTCTATTTTAAACTATTCTCTAANAACCAATATACACAACTCCAAACACCACCAACCCCTAACACAACTCCTTCTAAATACATTTACCAAACNCTAATTTTNNTNCTTTTTAANTACTTTTTTTTAATNTAATAAACACAAACCNTNNTTTTNAAAAAAAAACAAATAATCCACCCCANCAAAATAATAATNTTTTATTACAACATATACATTTCTTTAAAACAACCATAAACCAANAAAANNTANATATATNTANTNAANAATAAATCACACCAAACAAAACCCNCAAAAACTTNTTTTNNNNAAANAANNNNAAANAACAAANNAATNNTNNTANNAAANANANANNNTTATANNAAAAAAANNNCANNANACAAAAAAAAAAATNATATNTTAATTNNATNTTNAAANATAATAANNTNNNNANNANANANNNNNATAANNNAATAANNAAAAANTATAAANNAANANNNAAAANNAANAANANAANTNAAAAANNNAAAANACANANNAAAAAAANANNNAAANATAANNNNNNNNTAANAANNATAAACNNNTNNAANAANAANNNTNNNNNNNNAAANNNANNNNANNTATNNNCNNTNNNNNNANANNNNAAAANNAAAAANNNNAACNNNANNAANNNAAAAATNAAAAAAATNANANNNNANNNNNANNNANNNNNNNNTNTNNNANAAANNNTANNNNNNATAAACCNNNNNANNNNNACNNNNAANNNNNAANNNNNNAANNNANNNAAANNNNNNCNNNNNNNTNCNANANNNNNCNNNATATNAATNTNANTNTTNCAANCCCNNNNTCAANANNTNNNNNNNNNNNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGGAGTCTCTGCTGCAA