ORFeome > tmlhe ORF1 – XORFeome v1.0

tmlhe ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmlhe
Gene ID: 978208
Gene Page ID: 978202
ORF Xenbase ID: 17301711

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130136
Original XGC clone length: 1266

Human orthology & disease relationships

NCBI Entrez ID: 55217
Ensembl gene IDs: ENSG00000185973
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 154500,229100,236250,250940,253300,253400,253550,259900,600334,600794,601472,603689,604145,605899,606664,608688,608807,608808

Library Location

Plate ID: GDExl11090
Well Location: E07

Sequences - 5ʹ (forward) EST

Accession: JZ838604
dbEST ID: 79656306
Trimmed Sequence: ATGTGGTGTCGCAGGCTGGCAGGTTTTTATCCAGTTGCAAAAGCACTGCAAACCCTTGTGGTCAGAAAACAGGTTTTAAGACCATCCATCTTCCATAAGAATGTTACGTCTGTACATCGCTGGTTCAGTACATCACCAGAGATTAATGTCTGCTCTTGGGTTCTTCACAATGATCACCTTGAGATACTTTATTCTGGAACCTGTATGCGCTTTAATTATGTGTGGTTGCGTGATCATTGTCGCTCAGCTTCCTGTTTCAATGCCAAAACCAACCAGCGTAGCTTGGACACAGCCAGCGTGGAACTCGATATCCAACCTGCTCAGGTGCGAGCGGATGAGACCACTCTATACCTCACTTGGCCAGATGGTCACATGACCAGATATGGGCTAGAATGGTTGGTGCAAAATAGCTATGAAGGTCAGAAACATCAGCTGATCCAGCCTCGAATCTTGTGGAATGAAAGGATCTACAAAAAGGCAAATGTCCCATCTGTCAGCTATTCAGAGTTTCTGGAAACAAACGAGGGACTGAGAGAATTCCTGCAGAATTTCTTGCTCTATGGCATAGCTTTTGTTGATGATGTTCCACCAACCCACGACGAAACGGAGAAAATACCAAAAACAATAACCATATCAAGGAAACTATCTATGGTAAAATGTGGGATCTTACTTCTGAATTCTCCCGTTGAAAACCAAGTTAACCCAAGATTTACCCTTGAATCGTCGCACAGAATCCCACAAAACTTTCAAAAACCCTTTTCGACAAGAAAAATAATTCAACTGGTTTATCCTCCCTTAAAGGTGAAATGGGG
Full Trace Sequence: TCGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGTGTCGCAGGCTGGCAGGTTTTTATCCAGTTGCAAAAGCACTGCAAACCCTTGTGGTCAGAAAACAGGTTTTAAGACCATCCATCTTCCATAAGAATGTTACGTCTGTACATCGCTGGTTCAGTACATCACCAGAGATTAATGTCTGCTCTTGGGTTCTTCACAATGATCACCTTGAGATACTTTATTCTGGAACCTGTATGCGCTTTAATTATGTGTGGTTGCGTGATCATTGTCGCTCAGCTTCCTGTTTCAATGCCAAAACCAACCAGCGTAGCTTGGACACAGCCAGCGTGGAACTCGATATCCAACCTGCTCAGGTGCGAGCGGATGAGACCACTCTATACCTCACTTGGCCAGATGGTCACATGACCAGATATGGGCTAGAATGGTTGGTGCAAAATAGCTATGAAGGTCAGAAACATCAGCTGATCCAGCCTCGAATCTTGTGGAATGAAAGGATCTACAAAAAGGCAAATGTCCCATCTGTCAGCTATTCAGAGTTTCTGGAAACAAACGAGGGACTGAGAGAATTCCTGCAGAATTTCTTGCTCTATGGCATAGCTTTTGTTGATGATGTTCCACCAACCCACGACGAAACGGAGAAAATACCAAAAACAATAACCATATCAAGGAAACTATCTATGGTAAAATGTGGGATCTTACTTCTGAATTCTCCCGTTGAAAACCAAGTTAACCCAAGATTTACCCTTGAATCGTCGCACAGAATCCCACAAAACTTTCAAAAACCCTTTTCGACAAGAAAAATAATTCAACTGGTTTATCCTCCCTTAAAGGTGAAATGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGTGTCGCAGGCTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838603
dbEST ID: 79656305
Trimmed Sequence: AGCCTTTAGTCCCAGTAAGCGTGACGTGTTCAGGACATCATCTCGTGTGAGATAGCAGCCGCAAATCTGTCTGTATCCTGTGAAGGACTCTCTTCCATGCAAGACCCTCCAATTATCAACAAACAATACCTTTCCTGGTTTTAATTTTACCCATAATTCATTCTCTGGCCTTCTCAGTTCATTGGTCAACTTACGATGTGCATTATACCATTTCTGTATTACATCATAAGGCACAGTGCTGATCACAGACCGATCATAATTGTTGTACCTAATCATATAAAGCTCTTTATTCCATGGGTAAACATTTAACACAGGGCCGATCCCCACCATGTGATTATTACTTCCTGCCATGTTCTCAATATATTCGTGTTTCAGAGGTATGTTGCTGAGCAGTTCAAATTCATCTGGATGTTGGCGACGGACTTGATCAGCTGCATAGAATCCATCCACTAACAGCGTTCGACCCCCAGTCCCCTCATGCCGCACACAGTGGAATAGTTGCATGCCACAAGGCTCTTGGAAGTATGTGGTATCTGTGTGACGATCCAAGGCTAATTTGGTGTAAGCTGTGTCTCCACGTGAGAAGTCAGAAGTAAGATCCCACATCTTACCATAGATAGTTTCCCTGATATGGCTAATTCTCTCTGCTACCTTCTCTGTATCCTCCCGGGGTTGCTGGGAACATCATCAACCAAAAACTATGCCATAAAAGCAAGAAAATTCTGCAAAGAATTTCTCCTCAATCCCCCCTCCTTTTGTTTCCCCGAAAACCCCCG
Full Trace Sequence: GGGAATCTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCCTTTAGTCCCAGTAAGCGTGACGTGTTCAGGACATCATCTCGTGTGAGATAGCAGCCGCAAATCTGTCTGTATCCTGTGAAGGACTCTCTTCCATGCAAGACCCTCCAATTATCAACAAACAATACCTTTCCTGGTTTTAATTTTACCCATAATTCATTCTCTGGCCTTCTCAGTTCATTGGTCAACTTACGATGTGCATTATACCATTTCTGTATTACATCATAAGGCACAGTGCTGATCACAGACCGATCATAATTGTTGTACCTAATCATATAAAGCTCTTTATTCCATGGGTAAACATTTAACACAGGGCCGATCCCCACCATGTGATTATTACTTCCTGCCATGTTCTCAATATATTCGTGTTTCAGAGGTATGTTGCTGAGCAGTTCAAATTCATCTGGATGTTGGCGACGGACTTGATCAGCTGCATAGAATCCATCCACTAACAGCGTTCGACCCCCAGTCCCCTCATGCCGCACACAGTGGAATAGTTGCATGCCACAAGGCTCTTGGAAGTATGTGGTATCTGTGTGACGATCCAAGGCTAATTTGGTGTAAGCTGTGTCTCCACGTGAGAAGTCAGAAGTAAGATCCCACATCTTACCATAGATAGTTTCCCTGATATGGCTAATTCTCTCTGCTACCTTCTCTGTATCCTCCCGGGGTTGCTGGGAACATCATCAACCAAAAACTATGCCATAAAAGCAAGAAAATTCTGCAAAGAATTTCTCCTCAATCCCCCCTCCTTTTGTTTCCCCGAAAACCCCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCCTTTAGTCCCAGTAAGCGT