ORFeome > tmod4 ORF1 – XORFeome v1.0

tmod4 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tmod4
Gene ID: 5884975
Gene Page ID: 5884939
ORF Xenbase ID: 17301723

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078623
Original XGC clone length: 1041

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ839642
dbEST ID: 79657344
Trimmed Sequence: ATGTCTTACCAGAAGGACCTGGAGAAGTATCGGGATGTAGATGAGGATGCGCTCATGAAGGCCATGTCCCCAGAGGAACTGGCTCAGCTGGACTATGAGCTCCAGGAGATGGACCCAGAGAACATCCTTCTGCCAGCAGGCATGCGTCAGAAAGACCAAACCACAAAGAATGCGACTGGGCCACTAGACAGGGATGCCCTCTTACAGCACCTGGAGAAGGAAGCCATCGAGTACAAAGAAAGAGATGACCTGGTGCCTTTCACCGGAGAGAAAAAAGGGAAAGCTTTTGTACCCAAACAAGCCAAACGGGAGATCCCCCAAGAAGAGCAGATCACATTAGAGCCAGAGCTGGAGGAGGCTTTGGCCAACGCTACCGATGCAGAGATGTGCGACATTGCAGCTATCCTGGGCATGTACACCCTCATGAGTAACAAACAGTACTACGACGCCNTTACCTCTGGAATCATAACGAATAAGGAGGGCATCAACAGTGTGGTTAAGCCAGACACATACAAGCCAGTCCCGGATGAACCCCCAAATCCCACCAACGTGGAAGAGACTCTGAAAAAAATCCAGAGCAACGCGTCAGACCTAGTGGAGGTTAATCTGAATAATATCAAGGACATTCCTGTCCCAACGCTAAAGGAGATTTGCCAGGCCATGAAATGCAACAGCCATGTCACAACTCTGACCATGGTGGCGACACGTAGCAATGACCCCGTGGCCTATGCCGTGGCCGAAATGCCTGAAGGAGAACAAAACCCTTCCAAAGTCCTGAAGTTGAAGTCAAACTTTTACCCCCCGTTGCCGGGTATGT
Full Trace Sequence: CGGGGCCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTTACCAGAAGGACCTGGAGAAGTATCGGGATGTAGATGAGGATGCGCTCATGAAGGCCATGTCCCCAGAGGAACTGGCTCAGCTGGACTATGAGCTCCAGGAGATGGACCCAGAGAACATCCTTCTGCCAGCAGGCATGCGTCAGAAAGACCAAACCACAAAGAATGCGACTGGGCCACTAGACAGGGATGCCCTCTTACAGCACCTGGAGAAGGAAGCCATCGAGTACAAAGAAAGAGATGACCTGGTGCCTTTCACCGGAGAGAAAAAAGGGAAAGCTTTTGTACCCAAACAAGCCAAACGGGAGATCCCCCAAGAAGAGCAGATCACATTAGAGCCAGAGCTGGAGGAGGCTTTGGCCAACGCTACCGATGCAGAGATGTGCGACATTGCAGCTATCCTGGGCATGTACACCCTCATGAGTAACAAACAGTACTACGACGCCNTTACCTCTGGAATCATAACGAATAAGGAGGGCATCAACAGTGTGGTTAAGCCAGACACATACAAGCCAGTCCCGGATGAACCCCCAAATCCCACCAACGTGGAAGAGACTCTGAAAAAAATCCAGAGCAACGCGTCAGACCTAGTGGAGGTTAATCTGAATAATATCAAGGACATTCCTGTCCCAACGCTAAAGGAGATTTGCCAGGCCATGAAATGCAACAGCCATGTCACAACTCTGACCATGGTGGCGACACGTAGCAATGACCCCGTGGCCTATGCCGTGGCCGAAATGCCTGAAGGAGAACAAAACCCTTCCAAAGTCCTGAAGTTGAAGTCAAACTTTTACCCCCCGTTGCCGGGTATGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTTACCAGAAGGACC

Sequences - 3ʹ (reverse) EST

Accession: JZ839641
dbEST ID: 79657343
Trimmed Sequence: GACCTTCTTCTGCTTGCGACGAAGTTCCAGGTTCCTTGTGATGGCCGTGGCGGCTCGGGCTCTTGGTCCTTGTCGTGTGAAGTGATAGCCAAATCGTACGACTGAAGGGCAATTCTCAAGCATTGAGGCCATCTCCATCTCAACGGTGTCTCCCAGGTTCTGACGCTGGTTGTCCACTTTGAGCTCGGAGAGTGTGTTGTTGCTTCTCATGGCCTGGAGGATAGCCAACATACCGGCACTGGTGATAAAGTTGGACTCAACATTCAGACTTTGGAGGGTCTTGTTCTCCTTCAGCATTTCTGCCACGGCATAGGCCACGGGGTCATTGCTACGTGTCGCCACCATGGTCAGAGTTGTGACATGGCTGTTGCATTTCATGGCCTGGCAAATCTCCTTTAGCGTTGGGACAGGAATGTCCTTGATATTATTCAGATTAACCTCCACTAGGTCTGACGCGTTGCTCTGGATTTTTTTCAGAGTCTCTTCCACGTTGGTGGGATTTGGGGGGTTCGTCCGGGACTGGCTGGTATGTGTCTGGCTTAACCACACTGTTGAATCCCTCCTTTATCATTAGTGATCCCGAAGGTATGGCGTCGTAGTACTTGTTTGGGAGGCGGAGGGGTTACGTGCCCCAGAAAGCTGCGAGGTGGGAAATCTCGGCAACCCTCCCCTTTGGCCAAAGCGGCGGTCAACCTTTGGCTCAAAGGGAGATGTGCCTTTTTCTGAGGGGAATCCCCCCGGTTGGGGGTGGTGTTTGNCTTTAAAGGG
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACCTTCTTCTGCTTGCGACGAAGTTCCAGGTTCCTTGTGATGGCCGTGGCGGCTCGGGCTCTTGGTCCTTGTCGTGTGAAGTGATAGCCAAATCGTACGACTGAAGGGCAATTCTCAAGCATTGAGGCCATCTCCATCTCAACGGTGTCTCCCAGGTTCTGACGCTGGTTGTCCACTTTGAGCTCGGAGAGTGTGTTGTTGCTTCTCATGGCCTGGAGGATAGCCAACATACCGGCACTGGTGATAAAGTTGGACTCAACATTCAGACTTTGGAGGGTCTTGTTCTCCTTCAGCATTTCTGCCACGGCATAGGCCACGGGGTCATTGCTACGTGTCGCCACCATGGTCAGAGTTGTGACATGGCTGTTGCATTTCATGGCCTGGCAAATCTCCTTTAGCGTTGGGACAGGAATGTCCTTGATATTATTCAGATTAACCTCCACTAGGTCTGACGCGTTGCTCTGGATTTTTTTCAGAGTCTCTTCCACGTTGGTGGGATTTGGGGGGTTCGTCCGGGACTGGCTGGTATGTGTCTGGCTTAACCACACTGTTGAATCCCTCCTTTATCATTAGTGATCCCGAAGGTATGGCGTCGTAGTACTTGTTTGGGAGGCGGAGGGGTTACGTGCCCCAGAAAGCTGCGAGGTGGGAAATCTCGGCAACCCTCCCCTTTGGCCAAAGCGGCGGTCAACCTTTGGCTCAAAGGGAGATGTGCCTTTTTCTGAGGGGAATCCCCCCGGTTGGGGGTGGTGTTTGNCTTTAAAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACCTTCTTCTGCTTGCGAC