ORFeome > tnnc2 ORF1 – XORFeome v1.0

tnnc2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tnnc2
Gene ID: 865359
Gene Page ID: 480258
ORF Xenbase ID: 17301867

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099255
Original XGC clone length: 492

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ840108
dbEST ID: 79657810
Trimmed Sequence: ATGGCACAGCCTACAGATCAGCAACAAGATGCGAGGTCCTTCCTCAGCGAAGAAATGATCGCTGAGTTCAAAGCCGCCTTTGACATGTTTGACACTGATGGTGGCGGTGACATCAGCACCAAGGAGTTGGGAACTGTCATGAGGATGTTGGGACAGACCCCAACCAAGGAGGAGTTGGATGCCATCATTGAGGAAGTAGATGAGGACGGCAGCGGCACTATCGACTTTGAGGAGTTCTTGGTCATGATGGTGCGCCAGATGAAAGAGGATGCGCAGGGAAAAAGTGAAGAGGAGTTGGCTGAGTGCTTCCGCATTTTTGACAAGAATGCCGATGGGTACATTGATGGTGAGGAGTTAGCTGAAATCCTCCGTTCCTCAGGGGAGAGCATCACAGATGAGGAGATTGAAGAGCTTATGAAAGATGGAGACAAAAACAACGATGGCAAAATTGACTTTGATGAGTTCCTGAAGATGATGGAAGGTGTGCAATT
Full Trace Sequence: TTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCACAGCCTACAGATCAGCAACAAGATGCGAGGTCCTTCCTCAGCGAAGAAATGATCGCTGAGTTCAAAGCCGCCTTTGACATGTTTGACACTGATGGTGGCGGTGACATCAGCACCAAGGAGTTGGGAACTGTCATGAGGATGTTGGGACAGACCCCAACCAAGGAGGAGTTGGATGCCATCATTGAGGAAGTAGATGAGGACGGCAGCGGCACTATCGACTTTGAGGAGTTCTTGGTCATGATGGTGCGCCAGATGAAAGAGGATGCGCAGGGAAAAAGTGAAGAGGAGTTGGCTGAGTGCTTCCGCATTTTTGACAAGAATGCCGATGGGTACATTGATGGTGAGGAGTTAGCTGAAATCCTCCGTTCCTCAGGGGAGAGCATCACAGATGAGGAGATTGAAGAGCTTATGAAAGATGGAGACAAAAACAACGATGGCAAAATTGACTTTGATGAGTTCCTGAAGATGATGGAAGGTGTGCAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATTCCCTATAGTGAGTCGTATTACAGGGGTATAGCTGGTTCCAAAAACATCAGGCCCAGTGTTCAAAACCCTTAAAGTAAAACNGCNNGGNNGNNNGGGTGGGCCCCCCTCCCCCCCCGGGTTTGGGCTCTGTTCTTCCTTGCGGCGTCGCGGTCCCCCCTCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACAGCCTACAGATCAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ840107
dbEST ID: 79657809
Trimmed Sequence: TTGCACACCTTCCATCATCTTCAGGAACTCATCAAAGTCAATTTTGCCATCGTTGTTTTTGTCTCCATCTTTCATAAGCTCTTCAATCTCCTCATCTGTGATGCTCTCCCCTGAGGAACGGAGGATTTCAGCTAACTCCTCACCATCAATGTACCCATCGGCATTCTTGTCAAAAATGCGGAAGCACTCAGCCAACTCCTCTTCACTTTTTCCCTGCGCATCCTCTTTCATCTGGCGCACCATCATGACCAAGAACTCCTCAAAGTCGATAGTGCCGCTGCCGTCCTCATCTACTTCCTCAATGATGGCATCCAACTCCTCCTTGGTTGGGGTCTGTCCCAACATCCTCATGACAGTTCCCAACTCCTTGGTGCTGATGTCACCGCCACCATCAATGTCAAACATGTCAAAGGCGGCTTTGAACTCAGCGATCATTTCTTCGCTGAGGAAGGACCTCGCATCTTGTTGCTGATCTGTAGGCTGTGCCATGG
Full Trace Sequence: GGCGTGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGCACACCTTCCATCATCTTCAGGAACTCATCAAAGTCAATTTTGCCATCGTTGTTTTTGTCTCCATCTTTCATAAGCTCTTCAATCTCCTCATCTGTGATGCTCTCCCCTGAGGAACGGAGGATTTCAGCTAACTCCTCACCATCAATGTACCCATCGGCATTCTTGTCAAAAATGCGGAAGCACTCAGCCAACTCCTCTTCACTTTTTCCCTGCGCATCCTCTTTCATCTGGCGCACCATCATGACCAAGAACTCCTCAAAGTCGATAGTGCCGCTGCCGTCCTCATCTACTTCCTCAATGATGGCATCCAACTCCTCCTTGGTTGGGGTCTGTCCCAACATCCTCATGACAGTTCCCAACTCCTTGGTGCTGATGTCACCGCCACCATCAATGTCAAACATGTCAAAGGCGGCTTTGAACTCAGCGATCATTTCTTCGCTGAGGAAGGACCTCGCATCTTGTTGCTGATCTGTAGGCTGTGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAATAAAGCATTGCTCATCAATTTGTTGCAACAAAAAGGTCACTATCAGTCAAAAAAAATCATTATTTGGCGCAAAAAAATAAAACGGGACGTCGTTTACAAAAAACGAAAACAGGGATTTTACAAAAAGCCACGCACCTCTTGGCAACGGGGGCTTCGCGGGGGGAACGCGGCGGGGGAAAGAGGAAAAAGCGCAGAAAAGAGGAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGCACACCTTCCATCATCT