ORFeome > tnni1.2 ORF1 – XORFeome v1.0

tnni1.2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tnni1.2
Gene ID: 6077569
Gene Page ID: 485709
ORF Xenbase ID: 17301885

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054223
Original XGC clone length: 552

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ839353
dbEST ID: 79657055
Trimmed Sequence: ATGTCTGACGACTCAGAGAGAAAATCAAAAATCCCTGCTTCCAGAAAGTTACTTCTGAAGACTCTTATGCTACAAAAGGCTACTGAAGAGTTGGAAAAAGAGAAGAGAGACGCAGATGAGGAGAAGTCGAGGATTCTTGAAGCGAATGTTCCATCTTTACAAATTGCTGGGCTTTCCCTCCAGCAGCTGCAGGAACTGTGCACAAAACTACACAAACAAATTGATTCTGTAGATGAGGAACGTTATGACATTGAGTTAAAAGTAAAAAAGCACGACATAGAGATTGATGGTTTGACTCAAAAGATTTTTGACATGAAAGGCAAATTCAAGAGGCCTAACTTGAAAAGAGTGCGTATATCGGCAGATGCCATGCTTAAAGCCCTCCTGGGTACAACACACAAGGTTTCCGTAGATCTAAGAGCCAACCTGAAATCTGTAAGAAAGGAAGATGAGAAGGAAAAGGCAGTTGAAGTTACGGATTGGCGTAAAAACATTGAAGCCATGTCTGGCATGGAGGGCAGAAAGAAGAAATTTGACACCAGCAATGCTTT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGACGACTCAGAGAGAAAATCAAAAATCCCTGCTTCCAGAAAGTTACTTCTGAAGACTCTTATGCTACAAAAGGCTACTGAAGAGTTGGAAAAAGAGAAGAGAGACGCAGATGAGGAGAAGTCGAGGATTCTTGAAGCGAATGTTCCATCTTTACAAATTGCTGGGCTTTCCCTCCAGCAGCTGCAGGAACTGTGCACAAAACTACACAAACAAATTGATTCTGTAGATGAGGAACGTTATGACATTGAGTTAAAAGTAAAAAAGCACGACATAGAGATTGATGGTTTGACTCAAAAGATTTTTGACATGAAAGGCAAATTCAAGAGGCCTAACTTGAAAAGAGTGCGTATATCGGCAGATGCCATGCTTAAAGCCCTCCTGGGTACAACACACAAGGTTTCCGTAGATCTAAGAGCCAACCTGAAATCTGTAAGAAAGGAAGATGAGAAGGAAAAGGCAGTTGAAGTTACGGATTGGCGTAAAAACATTGAAGCCATGTCTGGCATGGAGGGCAGAAAGAAGAAATTTGACACCAGCAATGCTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCCTATATGGAGTCGTATTACATGGGAAATAAACTAAATACAAGAAACCTACTGGCCCGTGTCTCAACCAAAAAAAAAAAAGAAAAAAAAAAACANAAAAAATCGGGGGGCCCCAGGGGGGGGGACGGGGGGGGCCCTTTCCCTTTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGACGACTCAGAGAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839352
dbEST ID: 79657054
Trimmed Sequence: AGCATTGCTGGTGTCAAATTTCTTCTTTCTGCCCTCCATGCCAGACATGGCTTCAATGTTTTTACGCCAATCCGTAACTTCAACTGCCTTTTCCTTCTCATCTTCCTTTCTTACAGATTTCAGGTTGGCTCTTAGATCTACGGAAACCTTGTGTGTTGTACCCAGGAGGGCTTTAAGCATGGCATCTGCCGATATACGCACTCTTTTCAAGTTAGGCCTCTTGAATTTGCCTTTCATGTCAAAAATCTTTTGAGTCAAACCATCAATCTCTATGTCGTGCTTTTTTACTTTTAACTCAATGTCATAACGTTCCTCATCTACAGAATCAATTTGTTTGTGTAGTTTTGTGCACAGTTCCTGCAGCTGCTGGAGGGAAAGCCCAGCAATTTGTAAAGATGGAACATTCGCTTCAAGAATCCTCGACTTCTCCTCATCTGCGTCTCTCTTCTCTTTTTCCAACTCTTCAATAGCCTTTTGTAGCAAAAGAGTCTTCAGAAGTAACTTTCTGGAAGCAGGGATTTATGATTTTCTCTCTTAGTCGTCAGACATGGTGCCC
Full Trace Sequence: CGGGGATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCATTGCTGGTGTCAAATTTCTTCTTTCTGCCCTCCATGCCAGACATGGCTTCAATGTTTTTACGCCAATCCGTAACTTCAACTGCCTTTTCCTTCTCATCTTCCTTTCTTACAGATTTCAGGTTGGCTCTTAGATCTACGGAAACCTTGTGTGTTGTACCCAGGAGGGCTTTAAGCATGGCATCTGCCGATATACGCACTCTTTTCAAGTTAGGCCTCTTGAATTTGCCTTTCATGTCAAAAATCTTTTGAGTCAAACCATCAATCTCTATGTCGTGCTTTTTTACTTTTAACTCAATGTCATAACGTTCCTCATCTACAGAATCAATTTGTTTGTGTAGTTTTGTGCACAGTTCCTGCAGCTGCTGGAGGGAAAGCCCAGCAATTTGTAAAGATGGAACATTCGCTTCAAGAATCCTCGACTTCTCCTCATCTGCGTCTCTCTTCTCTTTTTCCAACTCTTCAATAGCCTTTTGTAGCAAAAGAGTCTTCAGAAGTAACTTTCTGGAAGCAGGGATTTATGATTTTCTCTCTTAGTCGTCAGACATGGTGCCCACCTTTTTTGTAACAAATTTGGCATTATAAAAAAACAATGCTCATTCAATTTGTGCAACGAACAGGGTCACTATCAAAAAAAAAAAAAATCATAAATTTGGGGCCGGAGCTAAAAACTGGCCGTCGTTTACAATTCCTTTGTGGAACTGGGGGCGNNGGAGAAAGGGGGGGCCTTTACTCTTTTTTTACCTGTATTATCTCCCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCATTGCTGGTGTCAAATTTC