ORFeome > tnni1 ORF1 – XORFeome v1.0

tnni1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tnni1
Gene ID: 981224
Gene Page ID: 981221
ORF Xenbase ID: 17301879

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129649
Original XGC clone length: 564

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ838662
dbEST ID: 79656364
Trimmed Sequence: ATGCCTGAACTTGAGAGGAAATCGAAAATTTCAGCATCCCGCAAACTCTTACTAAAGAGTTTAATGCTGGCAAAAGCAAAGGAGGCATGGGATCAGGATCATATCAATACACAAGAAGAAAAGGAAAAATACTTAAATGAGAGAGTACCCCGTGAAAACTACCTTGGCCTTTCACTAACTGTACTACAGGAATTATGCAGAGATTTACATGAAAAAGTTGGCATTGTGGATGAGGAAAGATATGATATTGAAGTCAAAGTCAATCACAACACCAGGGAGATTCAAGATCTGAGGATGAAGGTGCTGGATCTTCGTGGGAAGTTTAAGAGGCCTGCTCTGCGCAGAGTACGAGTATCTGCAGATGCCATGCTTCGTGCACTTTTGGGTTCAAAGCACAAGGTTTCCATGGACCTCCGTGCCAATTTGAAATCTGTAAAGAAAGAGGACACTGAGAAGGAACGCCCAGTTGAAGTGAGTGATTGGCGCAAAAATGTGGAAGCAATGTCTGGTATGGAGGGAAGAAAGAAAATGTTTGATGCCGCAAAATCACCTCCTGCACAATT
Full Trace Sequence: CTCGAGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTGAACTTGAGAGGAAATCGAAAATTTCAGCATCCCGCAAACTCTTACTAAAGAGTTTAATGCTGGCAAAAGCAAAGGAGGCATGGGATCAGGATCATATCAATACACAAGAAGAAAAGGAAAAATACTTAAATGAGAGAGTACCCCGTGAAAACTACCTTGGCCTTTCACTAACTGTACTACAGGAATTATGCAGAGATTTACATGAAAAAGTTGGCATTGTGGATGAGGAAAGATATGATATTGAAGTCAAAGTCAATCACAACACCAGGGAGATTCAAGATCTGAGGATGAAGGTGCTGGATCTTCGTGGGAAGTTTAAGAGGCCTGCTCTGCGCAGAGTACGAGTATCTGCAGATGCCATGCTTCGTGCACTTTTGGGTTCAAAGCACAAGGTTTCCATGGACCTCCGTGCCAATTTGAAATCTGTAAAGAAAGAGGACACTGAGAAGGAACGCCCAGTTGAAGTGAGTGATTGGCGCAAAAATGTGGAAGCAATGTCTGGTATGGAGGGAAGAAAGAAAATGTTTGATGCCGCAAAATCACCTCCTGCACAATTGCCAACTTTCTTGTACAAAGTTGGCAATTATAAGAAAGCATTGGCTTATCATTTGTTGCAACGAACAAGTCACAAACAGTCCAAAATACAATCATTAATTTGCCATCCAGCCTAAATTCCCGTATATTGGAGTCGTATTTACTGGGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAACGAAGACCGCAAAAAAATGAAAAAGAAAAAAAAAAAAGAAAAGGGAGTGCGGNGGGGGGGGGCGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTGAACTTGAGAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838661
dbEST ID: 79656363
Trimmed Sequence: TTGTGCAGGAGGTGATTTTGCGGCATCAAACATCTTCTTTCTTCCCTCCATACCAGACATTGCTTCCACATTTTTGCGCCAATCACTCACTTCAACTGGGCGTTCCTTCTCAGTGTCCTCTTTCTTTACAGATTTCAAATTGGCACGGAGGTCCATGGAAACCTTGTGCTTTGAACCCAAAAGTGCACGAAGCATGGCATCTGCAGATACTCGTACTCTGCGCAGAGCAGGCCTCTTAAACTTCCCACGAAGATCCAGCACCTTCATCCTCAGATCTTGAATCTCCCTGGTGTTGTGATTGACTTTGACTTCAATATCATATCTTTCCTCATCCACAATGCCGACTTTTTCATGTAAATCTCTGCATAATTCCTGTAGTACAGTTAGTGAAAGGCCAAGGTAGTTTTCACGGGGTACTCTCTCATTTAACTATTTTTCCTTTTCTTCTTGTGTAGTGATATGATCCTGATCCCATGCCTCCTTTCCTTTTGCCACCCTTAAACTCTTTAGTAAGAATATGCGGGATGGTGGAAGTTTTCTAATTCCTCTCCAGTTCGGGCATTGGGGCCACGTTTTTGTACTAAGTTTACATTAGTACAAAACATTACTCCTCCATTTTTTTCCACTAAAAGGGTCCGATGAGGTCAAATAAAGTCTTATAAAAAAAACAAAAAAGAAAAAAAAGAAAAACACGCGAAACAAACACAAAAGCGAGAAAAGGGAGAGAGAGGGGGAGAGNNNNNGGNNNTCTTNGTCNCNNNACGNNGGAG
Full Trace Sequence: GGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGTGCAGGAGGTGATTTTGCGGCATCAAACATCTTCTTTCTTCCCTCCATACCAGACATTGCTTCCACATTTTTGCGCCAATCACTCACTTCAACTGGGCGTTCCTTCTCAGTGTCCTCTTTCTTTACAGATTTCAAATTGGCACGGAGGTCCATGGAAACCTTGTGCTTTGAACCCAAAAGTGCACGAAGCATGGCATCTGCAGATACTCGTACTCTGCGCAGAGCAGGCCTCTTAAACTTCCCACGAAGATCCAGCACCTTCATCCTCAGATCTTGAATCTCCCTGGTGTTGTGATTGACTTTGACTTCAATATCATATCTTTCCTCATCCACAATGCCGACTTTTTCATGTAAATCTCTGCATAATTCCTGTAGTACAGTTAGTGAAAGGCCAAGGTAGTTTTCACGGGGTACTCTCTCATTTAACTATTTTTCCTTTTCTTCTTGTGTAGTGATATGATCCTGATCCCATGCCTCCTTTCCTTTTGCCACCCTTAAACTCTTTAGTAAGAATATGCGGGATGGTGGAAGTTTTCTAATTCCTCTCCAGTTCGGGCATTGGGGCCACGTTTTTGTACTAAGTTTACATTAGTACAAAACATTACTCCTCCATTTTTTTCCACTAAAAGGGTCCGATGAGGTCAAATAAAGTCTTATAAAAAAAACAAAAAAGAAAAAAAAGAAAAACACGCGAAACAAACACAAAAGCGAGAAAAGGGAGAGAGAGGGGGAGAGNNNNNGGNNNTCTTNGTCNCNNNACGNNGGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGTGCAGGAGGTGATTTTGCGG