ORFeome > tnnt3 ORF1 – XORFeome v1.0

tnnt3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tnnt3
Gene ID: 864889
Gene Page ID: 482604
ORF Xenbase ID: 17301909

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044998
Original XGC clone length: 831

Human orthology & disease relationships

NCBI Entrez ID: 7140
Ensembl gene IDs: ENSG00000130595
Directly associated (OMIM) disease MIM numbers: 601680
Indirectly associated (Lage, et al.) disease MIM numbers: 601680

Library Location

Plate ID: GDExl11012
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ823976
dbEST ID: 79641678
Trimmed Sequence: ATGTCTGACACAGAGGAAGTTGAACAGGTGGAGGAATACGAAGAAGAGGCACAAGAAGAAGAAAGCCAAGAGCAAGAAGAAGAACCAGTTGTGGAAGAGGCACCACAAGTAGAAGAAGCTTATGAGGAGGCTGAGGAAGAAGAACATGGTGAAGAATATGATGAGGAGAAGCCAAAGCCCAAGCTCACAGCCCCTAAAATCCCAGATGGAGAGAAAGTTGACTTTGATGATATCCAAAAGAAGAGGCAGAACAAAGACTTGATTGAACTGCAGTCTCTGATTGACACACACTTTGAGGCCCGCAAGAAAGAAGAAGAGGACATCATTGCCCTCAAAGACAGAATTGAGAAACGCAGAGCCGAGAGAGCTGAGCAGCTGAGGATCAGGACAGAGAAAGAAAAGGAGCGTCAGACCAGATTGGCTGAAGAGAAAGCAAGGAGAGAGGAACAGGATTTAATGAGACGTGCAGAGGATGACATGAAGAAGAAGAAGGCTCTGTCCTCCATGGGTGCCACATACAGCAGCTACCTGGCCAAGGCTGACCAGAAGAGAGGCAAGAAGCAGACAGCCCGTGAGATGAAGAAGAAGATTCTGGCTGACCGTCGCANACCACTGAATGTTGACCACATGAATGATGATAAGCTCAGGGAAAGGCAAAGGAAATGTGGGACTGGCTGTACCAGTTGGAGTCTGAGAAGTTTGAGATGGGAGAGAAACTCANGAAACAGAAATACGAGGATACGACTCTGCCCCAGGAGAGTAAAAGAAACCCTCCAGGTTCACCCAAGAAGGCGGCCGGAGGGCAAAGGGAAAAATTGGGGG
Full Trace Sequence: AATGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGACACAGAGGAAGTTGAACAGGTGGAGGAATACGAAGAAGAGGCACAAGAAGAAGAAAGCCAAGAGCAAGAAGAAGAACCAGTTGTGGAAGAGGCACCACAAGTAGAAGAAGCTTATGAGGAGGCTGAGGAAGAAGAACATGGTGAAGAATATGATGAGGAGAAGCCAAAGCCCAAGCTCACAGCCCCTAAAATCCCAGATGGAGAGAAAGTTGACTTTGATGATATCCAAAAGAAGAGGCAGAACAAAGACTTGATTGAACTGCAGTCTCTGATTGACACACACTTTGAGGCCCGCAAGAAAGAAGAAGAGGACATCATTGCCCTCAAAGACAGAATTGAGAAACGCAGAGCCGAGAGAGCTGAGCAGCTGAGGATCAGGACAGAGAAAGAAAAGGAGCGTCAGACCAGATTGGCTGAAGAGAAAGCAAGGAGAGAGGAACAGGATTTAATGAGACGTGCAGAGGATGACATGAAGAAGAAGAAGGCTCTGTCCTCCATGGGTGCCACATACAGCAGCTACCTGGCCAAGGCTGACCAGAAGAGAGGCAAGAAGCAGACAGCCCGTGAGATGAAGAAGAAGATTCTGGCTGACCGTCGCANACCACTGAATGTTGACCACATGAATGATGATAAGCTCAGGGAAAGGCAAAGGAAATGTGGGACTGGCTGTACCAGTTGGAGTCTGAGAAGTTTGAGATGGGAGAGAAACTCANGAAACAGAAATACGAGGATACGACTCTGCCCCAGGAGAGTAAAAGAAACCCTCCAGGTTCACCCAAGAAGGCGGCCGGAGGGCAAAGGGAAAAATTGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGACACAGAGGAAGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ829285
dbEST ID: 79646987
Trimmed Sequence: CTTCCAGCGGCCCCCAACTTTTCCTTTGCCTCCGGCTGCCTTCTTGCTGAACTTGGAGAGTTCCTCTACTCTCCTGTGCAGAGTCGTAATCTCGTATTTCTGTTTCTTGAGTTTCTCTCCCATCTCAAACTTCTCAGACTCCAACTGGTACAGCCAGTCCCACATTTCCTTTGCCTTTTCCCTGAGCTTATCATCATTCATGTGGTCAACATTCAGTGGTTTGCGACGGTCAGCCAGAATCTTCTTCTTCATCTCACGGGCTGTCTGCTTCTTGCCTCTCTTCTGGTCAGCCTTGGCCAGGTAGCTGCTGTATGTGGCACCCATGGAGGACAGAGCCTTCTTCTTCTTCATGTCATCCTCTGCACGTCTCATTAAATCCTGTTCCTCTCTCCTTGCTTTCTCTTCAGCCAATCTGGTCTGACGCTCCTTTTCTTTCTCTGTCCTGATCCTCAGCTGCTCAGCTCTCTCGGCTCTGCGTTTCTCAATTCTGTCTTTGAGGGCAATGATGTCCTCTTCTTCTTTCTTGCGGGCCTCAAAGTGTGTGTCAATCAAAGACTGCAGTTCAATCAAGTCTTTGTTCTGCCTCTTCTTTTGGATATCATCCAAGTCAACTTTCTCTCCATCTGGGAATTTAGGGGGCTGTGAGCTTGGGGCTTTGGGCTCTCCTCCATCATATTCTTCACCAGGTTCTTCCTTCCTCAACCCTCCTCATAAAGCTTCTTCCATCCTGGGGGGTCCCCCTTCCACCAAAGGGGGTTTCTTCTTTTTTGGG
Full Trace Sequence: GGACAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCCAGCGGCCCCCAACTTTTCCTTTGCCTCCGGCTGCCTTCTTGCTGAACTTGGAGAGTTCCTCTACTCTCCTGTGCAGAGTCGTAATCTCGTATTTCTGTTTCTTGAGTTTCTCTCCCATCTCAAACTTCTCAGACTCCAACTGGTACAGCCAGTCCCACATTTCCTTTGCCTTTTCCCTGAGCTTATCATCATTCATGTGGTCAACATTCAGTGGTTTGCGACGGTCAGCCAGAATCTTCTTCTTCATCTCACGGGCTGTCTGCTTCTTGCCTCTCTTCTGGTCAGCCTTGGCCAGGTAGCTGCTGTATGTGGCACCCATGGAGGACAGAGCCTTCTTCTTCTTCATGTCATCCTCTGCACGTCTCATTAAATCCTGTTCCTCTCTCCTTGCTTTCTCTTCAGCCAATCTGGTCTGACGCTCCTTTTCTTTCTCTGTCCTGATCCTCAGCTGCTCAGCTCTCTCGGCTCTGCGTTTCTCAATTCTGTCTTTGAGGGCAATGATGTCCTCTTCTTCTTTCTTGCGGGCCTCAAAGTGTGTGTCAATCAAAGACTGCAGTTCAATCAAGTCTTTGTTCTGCCTCTTCTTTTGGATATCATCCAAGTCAACTTTCTCTCCATCTGGGAATTTAGGGGGCTGTGAGCTTGGGGCTTTGGGCTCTCCTCCATCATATTCTTCACCAGGTTCTTCCTTCCTCAACCCTCCTCATAAAGCTTCTTCCATCCTGGGGGGTCCCCCTTCCACCAAAGGGGGTTTCTTCTTTTTTGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCCAGCGGCCCCCAA