ORFeome > tor4a ORF1 – XORFeome v1.0

tor4a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tor4a
Gene ID: 975365
Gene Page ID: 975359
ORF Xenbase ID: 17302035

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123214
Original XGC clone length: 1263

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: C10

Sequences - 5ʹ (forward) EST

Accession: JZ838271
dbEST ID: 79655973
Trimmed Sequence: ATGGAAGAAACCGAATCTAGTACGCAAACACCTGTGCCCCAACATGGGATTTCCTTGGCATCCTACCCTGTGCGGGCAGTCATCCGAATGCGCAGGAAGATCCGGACGCTGAAAAAGAGCAGGCTTCAGCTGGACCTGACTGGGGGGCGCTCTTTGGACAGCGCCAAGGCGTCTTTACGTCGGCAGATTTCCATGGACAGGGCCACCTTATTTAAGTCGTCCACCTATGAAAAACAGCAGTATTTTAATTTTGACACACCCACTTTGGAGAAACTGGCTTTAAATAGCCAAATCCGCAAAAGGAATCGCAAGAAGTCGAGGCACGTGCTGTACCCCGGCAACGTCAGGAAGTGTCTCCCCGTTGAGCATAAGAGCAAGGCCAAGCGTTGCCTCCTACTCTTCATAGGGATTGTTTGCTTTCAGATTCTCAACGCCATCGAGAATTTGGATGATAACCTTCAGAAATATGATTTAGATGGACTGGAAAAGACTTTGCAGAGGGAAGTGTTTGGGCAAAAAAGAGCCATTGAGAAATTAATGGACCACCTGCAGGATTATCTAGCCACACATTATCATAACAAGCCTTTAGTTCTTTCATTTTATGGGCCCAGTGGGGTCGGCAAGAGCCACACAAGGCCGATTGTTTGGCCAACATTTCCCTTTCCCTTAGAATAACAATTTTTTTCTTCATATTATACAATTCCCAACGCCCCCATGAAAATGATTTCACCCATTGGCAATCTAAAGAATGTCTGGGTTTAAATTCGGAAAAAGATCTCTTTAGGGTTAAAAATTTTAGAGAAAAAAAACCCT
Full Trace Sequence: CGAGGCACCACATAATAGATTTTATGTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGAAACCGAATCTAGTACGCAAACACCTGTGCCCCAACATGGGATTTCCTTGGCATCCTACCCTGTGCGGGCAGTCATCCGAATGCGCAGGAAGATCCGGACGCTGAAAAAGAGCAGGCTTCAGCTGGACCTGACTGGGGGGCGCTCTTTGGACAGCGCCAAGGCGTCTTTACGTCGGCAGATTTCCATGGACAGGGCCACCTTATTTAAGTCGTCCACCTATGAAAAACAGCAGTATTTTAATTTTGACACACCCACTTTGGAGAAACTGGCTTTAAATAGCCAAATCCGCAAAAGGAATCGCAAGAAGTCGAGGCACGTGCTGTACCCCGGCAACGTCAGGAAGTGTCTCCCCGTTGAGCATAAGAGCAAGGCCAAGCGTTGCCTCCTACTCTTCATAGGGATTGTTTGCTTTCAGATTCTCAACGCCATCGAGAATTTGGATGATAACCTTCAGAAATATGATTTAGATGGACTGGAAAAGACTTTGCAGAGGGAAGTGTTTGGGCAAAAAAGAGCCATTGAGAAATTAATGGACCACCTGCAGGATTATCTAGCCACACATTATCATAACAAGCCTTTAGTTCTTTCATTTTATGGGCCCAGTGGGGTCGGCAAGAGCCACACAAGGCCGATTGTTTGGCCAACATTTCCCTTTCCCTTAGAATAACAATTTTTTTCTTCATATTATACAATTCCCAACGCCCCCATGAAAATGATTTCACCCATTGGCAATCTAAAGAATGTCTGGGTTTAAATTCGGAAAAAGATCTCTTTAGGGTTAAAAATTTTAGAGAAAAAAAACCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGAAACCGAATCTAGTACG

Sequences - 3ʹ (reverse) EST

Accession: JZ838270
dbEST ID: 79655972
Trimmed Sequence: TGTATATGGCTGTAGGAGATTGACCTTGGCTACAACCTGTTTGCATCCCGAGATGGAGTACTCCTTGTTTTCCTTAGTGTAGTACCGGAGCTGGCCCGCTAGGCTCTCGATGTTACTATGGTCTGGATAAAAGCCTTCCCGTAGCAGTTCATCTAAGAAACAATCTAAAATGTGTTTTTTCTCCAAGAGGGTAAAAGGAACAATCTCTGCAACATCCCAGAGCGAGTGATGTTTCTGTAGGGAGCTGATTACAATCTGGTGGAGTTCCTGGGGAAGGTTGAGGAAGTCGTTGGAAGCATTCTGCAGAACAAACTTGGTGATCTCGTTGCCCCCGATATTGCTGATGAGGATATACACGGCGTTCAGATACTCGTTGCTTTGATTGAGCTGGAAGTACCTGTGCAGCACATCCAATAGTGCCACGGGCATGACCTCTACCTCATCAAATATAAACACAGGGATCTTCTCCTCAATCTCAGCCCTAGAGATCATCTCCGATATCAAACCAGACATCTCTGATTGGCACTGGGTGACATCATTCTCATTGTGTCAGTTGTGCATAGTATAATATTGAAAAACAAAATCGTTATCCATAATGGAACGGAAATGTTTTGGCCAACCATCAGCCCTGTGTGGCTCCTTGCCGACCCCACCGCCCCCCATTAAATGAAAGAAACTAAAGGCCTGGTTATGATAAATTGTGTGCCTAGAAAAATCCTGCCGGGGGGGTCCATTTAGTTTTCCCAATGGGCCTCCTTTTTTTTCCCCAGAGCCCTTTT
Full Trace Sequence: GGGAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTATATGGCTGTAGGAGATTGACCTTGGCTACAACCTGTTTGCATCCCGAGATGGAGTACTCCTTGTTTTCCTTAGTGTAGTACCGGAGCTGGCCCGCTAGGCTCTCGATGTTACTATGGTCTGGATAAAAGCCTTCCCGTAGCAGTTCATCTAAGAAACAATCTAAAATGTGTTTTTTCTCCAAGAGGGTAAAAGGAACAATCTCTGCAACATCCCAGAGCGAGTGATGTTTCTGTAGGGAGCTGATTACAATCTGGTGGAGTTCCTGGGGAAGGTTGAGGAAGTCGTTGGAAGCATTCTGCAGAACAAACTTGGTGATCTCGTTGCCCCCGATATTGCTGATGAGGATATACACGGCGTTCAGATACTCGTTGCTTTGATTGAGCTGGAAGTACCTGTGCAGCACATCCAATAGTGCCACGGGCATGACCTCTACCTCATCAAATATAAACACAGGGATCTTCTCCTCAATCTCAGCCCTAGAGATCATCTCCGATATCAAACCAGACATCTCTGATTGGCACTGGGTGACATCATTCTCATTGTGTCAGTTGTGCATAGTATAATATTGAAAAACAAAATCGTTATCCATAATGGAACGGAAATGTTTTGGCCAACCATCAGCCCTGTGTGGCTCCTTGCCGACCCCACCGCCCCCCATTAAATGAAAGAAACTAAAGGCCTGGTTATGATAAATTGTGTGCCTAGAAAAATCCTGCCGGGGGGGTCCATTTAGTTTTCCCAATGGGCCTCCTTTTTTTTCCCCAGAGCCCTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTATATGGCTGTAGGAGATTGA