ORFeome > tp53bp2 ORF1 – XORFeome v1.0

tp53bp2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tp53bp2
Gene ID: 962020
Gene Page ID: 962013
ORF Xenbase ID: 17302059

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC128681
Original XGC clone length: 3336

Human orthology & disease relationships

NCBI Entrez ID: 7159
Ensembl gene IDs: ENSG00000143514
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,104300,124200,133239,151623,209950,211980,228600,236490,260500,275355,300009,300291,300301,300400,300554,300584,308300,308990,310468,600072,601859,603218,603813,603909,606843,608354,608355,609065

Library Location

Plate ID: GDExl11083
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ837433
dbEST ID: 79655135
Trimmed Sequence: ATGTTCCTTACCGTGTACCTGAGGGGATCCCTGGGGATATTCTCCCCCCTCCACCTCCTCCGGAAGAGCTGAATGTAGTTACACCCCAGCCCCCTGACGCATTCATAGAGGAGTACCCCCCATATCCTCCCCCTCCTTATCCCACCTCTGGGGAACAAGACAGTCTGGTTGAAGATCTATCCAACATGCGACCTCCAGAGATCACTGGCCATTTCTCTCTTCCTCCTGGTAAAAGGACGAACCTGAGGAAGAATGGATCTGAGCGAATTAGTCATGGAATGAGAGTGAAATTTAACCCACTGGCTTTGCTCCTTGATTCATCTTTAGAAGGTGAATTCGACCTTGTACAGAGAATAATCTATGAGGTTGAGGATCCCAGCCAGCCTAATGATGAAGGTATCACAGCCCTGCATAACGCAGTGTGTGCCGGTCACACCGAGATTGTGAAGTTCTTGGTCCAGTTTGGGGTGAATGTAAATGCAGCAGACAGTGATGGCTGGACCCCATTACACTGCGCCGCGTCGTGCAATAACGTGCANGTGTGTAAGTTCCTGGTAGAGTCTGGAGCGGCTGTGTTTGCTACAACCTACAGTGATCGACAGACTGCTGCGGACAAGTGCGAGGAGATGGAGGAGGGCTACAGCCAGTGCTCCCAGTTTCTTTATGGTGTCCAAAAAAGATGGGCATATTAACCCGGGGGTGCTCTACACCTTGTGGGACTATTAAGCAAAAAATTGACATTAAAATGGCTCCTAAGGGAGGAAAACTGTAATAACCTCCCCTCCCCCAGGGAAAAAATAAGAATAAAAAACCAAA
Full Trace Sequence: CGGGGCCCCAATAATAGGATTTTATTTTGACTGATAGTGACCTGTATCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTCCTTACCGTGTACCTGAGGGGATCCCTGGGGATATTCTCCCCCCTCCACCTCCTCCGGAAGAGCTGAATGTAGTTACACCCCAGCCCCCTGACGCATTCATAGAGGAGTACCCCCCATATCCTCCCCCTCCTTATCCCACCTCTGGGGAACAAGACAGTCTGGTTGAAGATCTATCCAACATGCGACCTCCAGAGATCACTGGCCATTTCTCTCTTCCTCCTGGTAAAAGGACGAACCTGAGGAAGAATGGATCTGAGCGAATTAGTCATGGAATGAGAGTGAAATTTAACCCACTGGCTTTGCTCCTTGATTCATCTTTAGAAGGTGAATTCGACCTTGTACAGAGAATAATCTATGAGGTTGAGGATCCCAGCCAGCCTAATGATGAAGGTATCACAGCCCTGCATAACGCAGTGTGTGCCGGTCACACCGAGATTGTGAAGTTCTTGGTCCAGTTTGGGGTGAATGTAAATGCAGCAGACAGTGATGGCTGGACCCCATTACACTGCGCCGCGTCGTGCAATAACGTGCANGTGTGTAAGTTCCTGGTAGAGTCTGGAGCGGCTGTGTTTGCTACAACCTACAGTGATCGACAGACTGCTGCGGACAAGTGCGAGGAGATGGAGGAGGGCTACAGCCAGTGCTCCCAGTTTCTTTATGGTGTCCAAAAAAGATGGGCATATTAACCCGGGGGTGCTCTACACCTTGTGGGACTATTAAGCAAAAAATTGACATTAAAATGGCTCCTAAGGGAGGAAAACTGTAATAACCTCCCCTCCCCCAGGGAAAAAATAAGAATAAAAAACCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCCTTACCGTGTACCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837432
dbEST ID: 79655134
Trimmed Sequence: CGCCAGAGATCGTTGCCTTGGCTTGATCCTTGGGTACAGCCCAAGCAGGTTGCGGGGGACATATCCCTCCTTGTCATTTAACCGGGCCCACCACCACTCTGTCTCATCTTCATCTTCCCTGCGCAGGATGGTCATACAGTCTCCTTCCTTCAGAGCCATCTCATCGTCACTCTCTGCTTCATAGTCCCACAAGGTGTAGAGCACCCCCCGGTTCATAATGCCCATCTTCTCTTGGACACCATAAAGAAACTGGGAGCACTGGCTGTAGCCCTCCTCCATCTCCTCGCACTTGTCCGCAGCAGTCTGTCGATCACTGTAGGTTGTAGCAAACACAGCCGCTCCAGACTCTACCAGGAACTTACACACTTGCACGTTATTGCACGACGCGGCGCAGTGTAATGGGGTCCAGCCATCACTGTCTGCTGCATTTACATTCACCCCAAACTGGACCAAGAGCTTCACAATCTCGGTGTGACCGGCACACACTGCGTTATGCAGGGCTGTGATACCTTCATCATTAGGCTGGCTGGGATCCTCAACCTCATAAATTATTCTCTGTACCAAGTCGAATTCACCTTTCTAAGATGAATCAAGGAGCAAAGCCATTGGGTTAAATTTCACTCTCCTTCCCTGAACAAGTCGCTCAAATCCCTTCTTCCTCAAGTTTCTCCCTTTTACCCGGAGGAAAAAAAAAAAATGGCCAATTGAATCTCTTGAAGGTTCGCATTGTTGGAAAAAAAACTTTCCACCCAAAAAGGTT
Full Trace Sequence: GAAACTGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGCCAGAGATCGTTGCCTTGGCTTGATCCTTGGGTACAGCCCAAGCAGGTTGCGGGGGACATATCCCTCCTTGTCATTTAACCGGGCCCACCACCACTCTGTCTCATCTTCATCTTCCCTGCGCAGGATGGTCATACAGTCTCCTTCCTTCAGAGCCATCTCATCGTCACTCTCTGCTTCATAGTCCCACAAGGTGTAGAGCACCCCCCGGTTCATAATGCCCATCTTCTCTTGGACACCATAAAGAAACTGGGAGCACTGGCTGTAGCCCTCCTCCATCTCCTCGCACTTGTCCGCAGCAGTCTGTCGATCACTGTAGGTTGTAGCAAACACAGCCGCTCCAGACTCTACCAGGAACTTACACACTTGCACGTTATTGCACGACGCGGCGCAGTGTAATGGGGTCCAGCCATCACTGTCTGCTGCATTTACATTCACCCCAAACTGGACCAAGAGCTTCACAATCTCGGTGTGACCGGCACACACTGCGTTATGCAGGGCTGTGATACCTTCATCATTAGGCTGGCTGGGATCCTCAACCTCATAAATTATTCTCTGTACCAAGTCGAATTCACCTTTCTAAGATGAATCAAGGAGCAAAGCCATTGGGTTAAATTTCACTCTCCTTCCCTGAACAAGTCGCTCAAATCCCTTCTTCCTCAAGTTTCTCCCTTTTACCCGGAGGAAAAAAAAAAAATGGCCAATTGAATCTCTTGAAGGTTCGCATTGTTGGAAAAAAAACTTTCCACCCAAAAAGGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGCCAGAGATCGTTGCCTT