ORFeome > tp53i11 ORF1 – XORFeome v1.0

tp53i11 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tp53i11
Gene ID: 5885172
Gene Page ID: 5885148
ORF Xenbase ID: 17302065

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC127417
Original XGC clone length: 570

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ837292
dbEST ID: 79654994
Trimmed Sequence: ATGGCCACCAAGTCGCCTCCCCCGTTAATGAAGAAGCACAGCCCGAACGAACCTGGTGAGCCGGCTGAAAACGCGCAAGATCCTCGGGGTGGGAGGTGAAGATGATGATGGAGAGGTCCACAGGTCTAAGATCTCTCAAGTTCTGGGAAATGAAATAAAATTCGCAGTACGAGAACCTCTCGGTTTGAGGTTATGGCAGTTCCTCTCGGCCGTCATGTTTACTGGGATCGCTGTCATGGCTCTGACCTTCCCAGATCAGCTGTTCGCAGCCGTGTTCGACAGTGGCCCCCTCAGCAGCAAGACTTCCACTCGTTTATACGGAGGGGCCCTTTTTAGCATTTCCCTCATTATATGGAACTCCATGTACACGTCGGAGAAAGTCATTATACGGTGGACGCTGCTGACGGAGGCCTGTTACCTCAGCATCCAGCTCATTGTGACTGCAGTGACGGTGATCGAGAGCGGAAGCTCCTCCCTGGCTGCCGCCGCCGTTCTCTGCGGCTGCCTTCTCTTTGCGCTGATCAGTATCTACTACTACTACCCTACTGGGTCGCCGACCCAAAGAAAATTTT
Full Trace Sequence: CTCGAGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCACCAAGTCGCCTCCCCCGTTAATGAAGAAGCACAGCCCGAACGAACCTGGTGAGCCGGCTGAAAACGCGCAAGATCCTCGGGGTGGGAGGTGAAGATGATGATGGAGAGGTCCACAGGTCTAAGATCTCTCAAGTTCTGGGAAATGAAATAAAATTCGCAGTACGAGAACCTCTCGGTTTGAGGTTATGGCAGTTCCTCTCGGCCGTCATGTTTACTGGGATCGCTGTCATGGCTCTGACCTTCCCAGATCAGCTGTTCGCAGCCGTGTTCGACAGTGGCCCCCTCAGCAGCAAGACTTCCACTCGTTTATACGGAGGGGCCCTTTTTAGCATTTCCCTCATTATATGGAACTCCATGTACACGTCGGAGAAAGTCATTATACGGTGGACGCTGCTGACGGAGGCCTGTTACCTCAGCATCCAGCTCATTGTGACTGCAGTGACGGTGATCGAGAGCGGAAGCTCCTCCCTGGCTGCCGCCGCCGTTCTCTGCGGCTGCCTTCTCTTTGCGCTGATCAGTATCTACTACTACTACCCTACTGGGTCGCCGACCCAAAGAAAATTTTGCCAAACTTTCTTGTACAAAGTTTGGATTTTAAGAAAAGCTTTGCTTATTCATTTTGTTGGAACGAAACGGTTCCATATTCATTCAAAATAAAATCTATTTATTGCCTTCCCNCCATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATATCTTGGCAGGCTCCTGGGCCCCTTGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCACCAAGTCGCCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ837291
dbEST ID: 79654993
Trimmed Sequence: AATCTTCTTGGGTCGGCGACCCAGTAGGTAGTAGTAGTAGATACTGATCAGCGCAAAGAGAAGGCAGCCGCAGAGAACGGCGGCGGCAGCCAGGGAGGAGCTTCCGCTCTCGATCACCGTCACTGCAGTCACAATGAGCTGGATGCTGAGGTAACAGGCCTCCGTCAGCAGCGTCCACCGTATAATGACTTTCTCCGACGTGTACATGGAGTTCCATATAATGAGGGAAATGCTAAAAAGGGCCCCTCCGTATAAACGAGTGGAAGTCTTGCTGCTGAGGGGGCCACTGTCGAACACGGCTGCGAACAGCTGATCTGGGAAAGTCAGAGCCATGACAGCGATCCCAGTAAACATGACGGCCGAGAGGAACTGCCCTAACCTCAAACCGAGAGGTTCTCGTACTGCGAATTTTATTTCATTTCCCAAAACTTGAGAAAACTTAAACCTTTGGACCTCTCCATCATCATCTTCACCGTCCACCCCCAAAAATATTGACGCGTTTTCACCGGCCTCACAAAGGTCGGTCTGGCTGGTGCTTCTTCTTAACGTGGGAAGGCGACATGGTTGCCATGGTTCCCAACANTTTGGGAACAAAGTTGGCATTAGAANAACACCAATGGCTCACCNATTTTGTTTTCGACGAACAGGGTGGGGTGGGGGTTCAAAAAGGAGAAAAAAAAAA
Full Trace Sequence: GGGAATCAGGCTATGACGCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATCTTCTTGGGTCGGCGACCCAGTAGGTAGTAGTAGTAGATACTGATCAGCGCAAAGAGAAGGCAGCCGCAGAGAACGGCGGCGGCAGCCAGGGAGGAGCTTCCGCTCTCGATCACCGTCACTGCAGTCACAATGAGCTGGATGCTGAGGTAACAGGCCTCCGTCAGCAGCGTCCACCGTATAATGACTTTCTCCGACGTGTACATGGAGTTCCATATAATGAGGGAAATGCTAAAAAGGGCCCCTCCGTATAAACGAGTGGAAGTCTTGCTGCTGAGGGGGCCACTGTCGAACACGGCTGCGAACAGCTGATCTGGGAAAGTCAGAGCCATGACAGCGATCCCAGTAAACATGACGGCCGAGAGGAACTGCCCTAACCTCAAACCGAGAGGTTCTCGTACTGCGAATTTTATTTCATTTCCCAAAACTTGAGAAAACTTAAACCTTTGGACCTCTCCATCATCATCTTCACCGTCCACCCCCAAAAATATTGACGCGTTTTCACCGGCCTCACAAAGGTCGGTCTGGCTGGTGCTTCTTCTTAACGTGGGAAGGCGACATGGTTGCCATGGTTCCCAACANTTTGGGAACAAAGTTGGCATTAGAANAACACCAATGGCTCACCNATTTTGTTTTCGACGAACAGGGTGGGGTGGGGGTTCAAAAAGGAGAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATCTTCTTGGGTCGGCG