ORFeome > tpgs2 ORF1 – XORFeome v1.0

tpgs2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tpgs2
Gene ID: 5836471
Gene Page ID: 5836443
ORF Xenbase ID: 17302107

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078549
Original XGC clone length: 834

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ839856
dbEST ID: 79657558
Trimmed Sequence: ATGGCATCTTACACCGAGAAACTGACTCTGGGCATCAGCAAAATCCTAGAATCTTCCCCTGGCATCTCTGAGGTGAAGTTTGATGAGAGGGCCCCTGCCGAACGCCACTTGATTGTTTCCTGGGAACAGAGGAACTCCTGCTTTCTGCCTGATGATCTGAAGAATTTTTATCTGATGACGGATGGATTCCTCATGTCTTGGAGCGTCAAGCTGGATGACAGCACCGTCCAAGTGGGATCTATGGTAATTAACAGCAATTCGGATCTGCTCCGCCTGGGAGGTTCCTCTGTATACGCCCTGCCCAATGCACCAACACTTGCTGACCTGGAGGATGAGCCTGAGGAAGAAGGTTGCCTGGAGCAGCCACACTTTGACTCTCGTAATGTGATCTTTGAACTGGATCCGTGCAGCAGCAATGGGAAAGTGTGTCTGGTTTATAAAACCTCAGAGTCAGGAGGGGCAGCATCTGACCCAGAAATCTGGTTCCTGGACAGGGCTCTCTATTGGCATTTCCTGACCCATAACTTTACTTCCTACTACCGGCTACTGCTGTCCCACCTGGGGCTACCTCAATGGCAGTATGCTTTCACCATTTTCGGACTGAGCCCTCAGGCCCAACAATGGTTTCACCACGTTGGGAACCATCACCTTTTGAACCCCAGCCGGTGCCCGAAAAAACTTGACACTTTTCTGAACAAACTGGAACCCCCACGGAATTTTCAGAAACAAAAACAAAACTTCCCCAACAAAAAAAAAAAACTCCCCCCCGCCCCCCTCTCCCCCCCCCAAAAAAGAAAAACCCCGGCCAAAAAAACCCCCTCTGG
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCATCTTACACCGAGAAACTGACTCTGGGCATCAGCAAAATCCTAGAATCTTCCCCTGGCATCTCTGAGGTGAAGTTTGATGAGAGGGCCCCTGCCGAACGCCACTTGATTGTTTCCTGGGAACAGAGGAACTCCTGCTTTCTGCCTGATGATCTGAAGAATTTTTATCTGATGACGGATGGATTCCTCATGTCTTGGAGCGTCAAGCTGGATGACAGCACCGTCCAAGTGGGATCTATGGTAATTAACAGCAATTCGGATCTGCTCCGCCTGGGAGGTTCCTCTGTATACGCCCTGCCCAATGCACCAACACTTGCTGACCTGGAGGATGAGCCTGAGGAAGAAGGTTGCCTGGAGCAGCCACACTTTGACTCTCGTAATGTGATCTTTGAACTGGATCCGTGCAGCAGCAATGGGAAAGTGTGTCTGGTTTATAAAACCTCAGAGTCAGGAGGGGCAGCATCTGACCCAGAAATCTGGTTCCTGGACAGGGCTCTCTATTGGCATTTCCTGACCCATAACTTTACTTCCTACTACCGGCTACTGCTGTCCCACCTGGGGCTACCTCAATGGCAGTATGCTTTCACCATTTTCGGACTGAGCCCTCAGGCCCAACAATGGTTTCACCACGTTGGGAACCATCACCTTTTGAACCCCAGCCGGTGCCCGAAAAAACTTGACACTTTTCTGAACAAACTGGAACCCCCACGGAATTTTCAGAAACAAAAACAAAACTTCCCCAACAAAAAAAAAAAACTCCCCCCCGCCCCCCTCTCCCCCCCCCAAAAAAGAAAAACCCCGGCCAAAAAAACCCCCTCTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCATCTTACACCGAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839855
dbEST ID: 79657557
Trimmed Sequence: TTTTCGTGTAGGATTTCCAGATCCCAAGGGGTTTCTGCCTGGGTTTCCTTTTTGGGGAGGAGCAGGTGCAGGGGGCAGTTTTCTCTTTGTTTGGGGAGTTTTGTTTTTGCTCTTGAAAATCCTGTTGGGGTCCAGTTTGTTCATGAAAGTGTCAGGTTCTTCAGGCACCGCTGTGGCTTCAAAGGTGATGGGTCTGTACGTGTTGAACCATTGCTTGGCCTGAGGGCTCAGTCCGTAACTGGTGAAAGCATACTGCCATTGAGGTAGCCCCAGGTGGGACAGCAGTAGCCGGTAGTAGGAAGTAAAGTTATGGGTCAGGAAATGCCAATAGAGAGCCCTGTCCAGGAACCAGATTTCTGGGTCAGATGCTGCCCCTCCTGACTCTGAGGTTTTATAAACCAGACACACTTTCCCATTGCTGCTGCACGGATCCAGTTCAAAGATCACATTACGAGAGTCAAAGTGTGGCTGCTCCAGGCAACCTTCTTCCTCAGGCTCATCCTCCAGGTCAGCAAGTGTTGGTGCATTGGGCAGGGCGTATACAGAGGAACCTCCCAGGCGGAACAAATCCGAATTGCTGTTAATTACCATAGATCCCCCTTGGAACGTGCTGTCATCCCGCTTGACCCTTCCAGACATGAGGAATCCATCCGTCCTCAAATTAAAAATCTTCAAATAATAAGGCAAAAAACAAGAATTTCCTCTGTTTCCCAGAAAAAAATCAAATTGGGCTGTCGGCCCGGGGCCCCTCTTCCCCAAACTTCCCCCGTCCAAAAAACCCCG
Full Trace Sequence: GAAAAGGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTCGTGTAGGATTTCCAGATCCCAAGGGGTTTCTGCCTGGGTTTCCTTTTTGGGGAGGAGCAGGTGCAGGGGGCAGTTTTCTCTTTGTTTGGGGAGTTTTGTTTTTGCTCTTGAAAATCCTGTTGGGGTCCAGTTTGTTCATGAAAGTGTCAGGTTCTTCAGGCACCGCTGTGGCTTCAAAGGTGATGGGTCTGTACGTGTTGAACCATTGCTTGGCCTGAGGGCTCAGTCCGTAACTGGTGAAAGCATACTGCCATTGAGGTAGCCCCAGGTGGGACAGCAGTAGCCGGTAGTAGGAAGTAAAGTTATGGGTCAGGAAATGCCAATAGAGAGCCCTGTCCAGGAACCAGATTTCTGGGTCAGATGCTGCCCCTCCTGACTCTGAGGTTTTATAAACCAGACACACTTTCCCATTGCTGCTGCACGGATCCAGTTCAAAGATCACATTACGAGAGTCAAAGTGTGGCTGCTCCAGGCAACCTTCTTCCTCAGGCTCATCCTCCAGGTCAGCAAGTGTTGGTGCATTGGGCAGGGCGTATACAGAGGAACCTCCCAGGCGGAACAAATCCGAATTGCTGTTAATTACCATAGATCCCCCTTGGAACGTGCTGTCATCCCGCTTGACCCTTCCAGACATGAGGAATCCATCCGTCCTCAAATTAAAAATCTTCAAATAATAAGGCAAAAAACAAGAATTTCCTCTGTTTCCCAGAAAAAAATCAAATTGGGCTGTCGGCCCGGGGCCCCTCTTCCCCAAACTTCCCCCGTCCAAAAAACCCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTCGTGTAGGATTTCCAGATC