ORFeome > tpm2 ORF1 – XORFeome v1.0

tpm2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tpm2
Gene ID: 6255811
Gene Page ID: 6071380
ORF Xenbase ID: 17302125

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054163
Original XGC clone length: 855

Human orthology & disease relationships

NCBI Entrez ID: 7169
Ensembl gene IDs: ENSG00000198467
Directly associated (OMIM) disease MIM numbers: 108120,601680,609285
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,104300,105120,108120,115200,123500,125853,131950,145980,182290,184500,211980,215600,226650,226670,600652,603278,604219,606595,607841,609285

Library Location

Plate ID: GDExl11001
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ839192
dbEST ID: 79656894
Trimmed Sequence: ATGGACGCGATTAAGAAGAAGATGCAGATGCTGAAGTTGGACAAGGAGAATGCGATTGATCGCGCGGAACAGGCCGAGGCGGATAAGAAACAGGCGGAGGATCGCTGGAAGCAGATAGAGGAGGAGGTGTTGGCTATGCAGAAGAAGACCAAGGGGACGGAGGATGAGGTGGAGAAATATTCGGAGTCAGTGAAAGATGCTCAGGAGAAGCTGGAGATGGCGGAGAAGAAGGCGACTGACGCTGAGGCTGAAGTAGCATCTTTGAACAGGCGCATCCAGCTGGTAGAGGAAGAGTTGGACCGTGCTCAGGAACGTCTTGCCACCGCTCTGCAGAAACTGGAAGAAACAGAGAAAGCAGTGGATGAGAGCGAGAGAGGCATGAAGGTCATTGAGAACAGGGCCACCAAGGATGGGGAGAAGATGGTGGACCAAGATCAGCAGCTGAAAGAAGCTAAAACCATAGCAGAGGATTCAGACCGCANGTATGAGGAGGTGGCCCGTAAGCTTGTCGGCATTGAGGGGGACCTGGAGCGTTCTGAAGAGCGAGCTGAGGTGGCTGAGAGTAAATGTGGGGATCTGGAGGAAGAGCTGAAAAACGTCACCCATAACTTGAAATCTCCTGAGGCACAGGCAAACAGTTTTCATCCAAGGGAGAACAATTTGAAGGAGGAGGTTCATCAGCTGAACTGAAAACCTAAAAGAAGCTTAAAAGTCCGGTTGGAATTTTTGCTGAAGAAATCGTGTGGTTTAAACTTGAAGGAAAAACCATTTGGAAGAACCCGGGGAAAGAAAAGAGGGGTTCAATTTCTCCCCAA
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACGCGATTAAGAAGAAGATGCAGATGCTGAAGTTGGACAAGGAGAATGCGATTGATCGCGCGGAACAGGCCGAGGCGGATAAGAAACAGGCGGAGGATCGCTGGAAGCAGATAGAGGAGGAGGTGTTGGCTATGCAGAAGAAGACCAAGGGGACGGAGGATGAGGTGGAGAAATATTCGGAGTCAGTGAAAGATGCTCAGGAGAAGCTGGAGATGGCGGAGAAGAAGGCGACTGACGCTGAGGCTGAAGTAGCATCTTTGAACAGGCGCATCCAGCTGGTAGAGGAAGAGTTGGACCGTGCTCAGGAACGTCTTGCCACCGCTCTGCAGAAACTGGAAGAAACAGAGAAAGCAGTGGATGAGAGCGAGAGAGGCATGAAGGTCATTGAGAACAGGGCCACCAAGGATGGGGAGAAGATGGTGGACCAAGATCAGCAGCTGAAAGAAGCTAAAACCATAGCAGAGGATTCAGACCGCANGTATGAGGAGGTGGCCCGTAAGCTTGTCGGCATTGAGGGGGACCTGGAGCGTTCTGAAGAGCGAGCTGAGGTGGCTGAGAGTAAATGTGGGGATCTGGAGGAAGAGCTGAAAAACGTCACCCATAACTTGAAATCTCCTGAGGCACAGGCAAACAGTTTTCATCCAAGGGAGAACAATTTGAAGGAGGAGGTTCATCAGCTGAACTGAAAACCTAAAAGAAGCTTAAAAGTCCGGTTGGAATTTTTGCTGAAGAAATCGTGTGGTTTAAACTTGAAGGAAAAACCATTTGGAAGAACCCGGGGAAAGAAAAGAGGGGTTCAATTTCTCCCCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACGCGATTAAGAAGAAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839191
dbEST ID: 79656893
Trimmed Sequence: AAGAGAGGTGATGTCATTGAGAGCATTGTCCAAATCCTCACTGATGGCTTTATATCTCATCTTCTGAGAATAGACCTCATCTTCCAGATCATCAATGGTCTTCTCTAGTTTAACCACAGATTTCTCAGCAAACTCAACCCGACTCTCAGCTTCTTTTAGCTTCTCAGTCAGCTGATTGACCTCCTCCTCATATTTGTCTTCCTTTGATGAATACTTGTCTGCTTGTGCCTCAAGGGATTTCAAGTTATTGGTGACGTTCTTCAGCTCTTCCTCCAGATCCCCACATTTACTCTCAGCCACCTCAGCTCGCTCTTCAGAACGCTCCAGGTCCCCCTCAATGCCGACAAGCTTACGGGCCACCTCCTCATACTTGCGGTCTGAATCCTCTGCTATGGTTTTAGCTTCTTTCAGCTGCTGATCTTGGTCCACCATCTTCTCCCCATCCTTGGTGGCCCTGTTCTCAATGACCTTCATGCCTCTCTCGCTCTCATCCACTGCTTTCTCTGTTTCTTCCAGTTTCTGCAAAGCGGTGGCAAGACGTTCCTGAGCACGGTCCAACTCTTCCTCTAACAGCTGGATGCGCCTGTTCAAAGATGCTACTTCACCCTCAGCGTCAGTCGCCTTCTTTCCCCGCATCCCCCACCTTCCCTTGAGCATCTTTTCCTGACTTCCAAAAATTTTCCCCACCTCCTTCCCCCCCCCCCCTTGGGTCTTTCCTTTGGCAAAAACCCAAACCCCTCCCTTCCCCCTTATCTTCCCTTCCCACCCGATA
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGAGAGGTGATGTCATTGAGAGCATTGTCCAAATCCTCACTGATGGCTTTATATCTCATCTTCTGAGAATAGACCTCATCTTCCAGATCATCAATGGTCTTCTCTAGTTTAACCACAGATTTCTCAGCAAACTCAACCCGACTCTCAGCTTCTTTTAGCTTCTCAGTCAGCTGATTGACCTCCTCCTCATATTTGTCTTCCTTTGATGAATACTTGTCTGCTTGTGCCTCAAGGGATTTCAAGTTATTGGTGACGTTCTTCAGCTCTTCCTCCAGATCCCCACATTTACTCTCAGCCACCTCAGCTCGCTCTTCAGAACGCTCCAGGTCCCCCTCAATGCCGACAAGCTTACGGGCCACCTCCTCATACTTGCGGTCTGAATCCTCTGCTATGGTTTTAGCTTCTTTCAGCTGCTGATCTTGGTCCACCATCTTCTCCCCATCCTTGGTGGCCCTGTTCTCAATGACCTTCATGCCTCTCTCGCTCTCATCCACTGCTTTCTCTGTTTCTTCCAGTTTCTGCAAAGCGGTGGCAAGACGTTCCTGAGCACGGTCCAACTCTTCCTCTAACAGCTGGATGCGCCTGTTCAAAGATGCTACTTCACCCTCAGCGTCAGTCGCCTTCTTTCCCCGCATCCCCCACCTTCCCTTGAGCATCTTTTCCTGACTTCCAAAAATTTTCCCCACCTCCTTCCCCCCCCCCCCTTGGGTCTTTCCTTTGGCAAAAACCCAAACCCCTCCCTTCCCCCTTATCTTCCCTTCCCACCCGATA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGAGAGGTGATGTCATTGAG