ORFeome > tpm4 ORF1 – XORFeome v1.0

tpm4 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tpm4
Gene ID: 6077166
Gene Page ID: 6077096
ORF Xenbase ID: 17302149

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054220
Original XGC clone length: 855

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: F05

Sequences - 5ʹ (forward) EST

Accession: JZ839275
dbEST ID: 79656977
Trimmed Sequence: ATGGAAGCAATTAAGAAGAAGATGCAGATGCTTAAGCTGGATAAGGAGAATGCCATAGATAGGGCAGAGCAAGCTGAAGCAGATAAGAAGGCAGCGGAGGACAAGTGCAAACAGGTAGAGGATGAGCTTGTGGCCCTGCAGAAGAAGCTGAAGGGAACAGAAGATGAGCTGGATAAATACTCTGAAGCTCTGAAGGATGCTCAGGAGAAACTGGAACAAGCAGATAAGAAGGCAACTGATGCTGAAGGGGAAGTAGCTGCACTAAACCGCCGTATCCAGCTTGTGGAGGAAGAGTTGGACAGAGCTCAGGAACGTCTTGCCACTGCTTTACAGAAATTGGAAGAAGCGGAGAAAGCAGCTGATGAAAGCGAGAGAGGTATGAAGGTGATTGAGAACAGGGCAATGAAGGATGAGGAGAAGATGGAAATTCAAGAAATGCAACTGAAAGAAGCTAAACACATTGCAGAGGATGCAGATCGGAAATATGAAGAGGTTGCTCGGAAACTGGTTATTCTTGAGGGAGAACTTGAAAGAGCAGAGGAGCGTGCAGAGGTGTCCGAACTCAAATGTAGTGATTTGGAAGAAGAACTGAAAAATGTGACTAACAACTTAAAATCCTTGGAGGCACAATCTGAGAAGTATTCTGNAAAAGAAGATAAATATGAAGAAGAAATAAAGATTTTAACAGAACAACTTTAAAAAGGCTGAAACCCCGGGCTGAATTTTGCGGAAAGGGAAAGTTGGCCAAAACTAAAAAAAGTCCAATGTGATGAACCTGGAAAAAACAACCTTGGGCAAGGCGCCCCAAAAAAAAGAAAA
Full Trace Sequence: CGAGGCCCCAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGCAATTAAGAAGAAGATGCAGATGCTTAAGCTGGATAAGGAGAATGCCATAGATAGGGCAGAGCAAGCTGAAGCAGATAAGAAGGCAGCGGAGGACAAGTGCAAACAGGTAGAGGATGAGCTTGTGGCCCTGCAGAAGAAGCTGAAGGGAACAGAAGATGAGCTGGATAAATACTCTGAAGCTCTGAAGGATGCTCAGGAGAAACTGGAACAAGCAGATAAGAAGGCAACTGATGCTGAAGGGGAAGTAGCTGCACTAAACCGCCGTATCCAGCTTGTGGAGGAAGAGTTGGACAGAGCTCAGGAACGTCTTGCCACTGCTTTACAGAAATTGGAAGAAGCGGAGAAAGCAGCTGATGAAAGCGAGAGAGGTATGAAGGTGATTGAGAACAGGGCAATGAAGGATGAGGAGAAGATGGAAATTCAAGAAATGCAACTGAAAGAAGCTAAACACATTGCAGAGGATGCAGATCGGAAATATGAAGAGGTTGCTCGGAAACTGGTTATTCTTGAGGGAGAACTTGAAAGAGCAGAGGAGCGTGCAGAGGTGTCCGAACTCAAATGTAGTGATTTGGAAGAAGAACTGAAAAATGTGACTAACAACTTAAAATCCTTGGAGGCACAATCTGAGAAGTATTCTGNAAAAGAAGATAAATATGAAGAAGAAATAAAGATTTTAACAGAACAACTTTAAAAAGGCTGAAACCCCGGGCTGAATTTTGCGGAAAGGGAAAGTTGGCCAAAACTAAAAAAAGTCCAATGTGATGAACCTGGAAAAAACAACCTTGGGCAAGGCGCCCCAAAAAAAAGAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGCAATTAAGAAGAAGATG

Sequences - 3ʹ (reverse) EST

Accession: JZ839274
dbEST ID: 79656976
Trimmed Sequence: TAAACTGCCCAGTTCTTGTAGTGCCTGATCCAGAACTTGATGCATGCCCAAGTTTTCTTCTTTGGCGCTTGCCAGCTTGTCTTCCAGGTCATCAATTGACTTTTCTAGTTTGGCCACTGTCCTTTCTGCAAATTCAGCCCGGGTTTCAGCCTCTTTAAGTTTGTCTGTTAAAATCTTTATTTCTTCTTCATATTTATCTTCTTTTTCAGAATACTTCTCAGATTGTGCCTCCAAGGATTTTAAGTTGTTAGTCACATTTTTCAGTTCTTCTTCCAAATCACTACATTTGAGTTCGGACACCTCTGCACGCTCCTCTGCTCTTTCAAGTTCTCCCTCAAGAATAACCAGTTTCCGAGCAACCTCTTCATATTTCCGATCTGCATCCTCTGCAATGTGTTTAGCTTCTTTCAGTTGCATTTCTTGAATTTCCATCTTCTCCTCATCCTTCATTGCCCTGTTCTCAATCACCTTCATACCTCTCTCGCTTTCATCAGCTGCTTTCTCCGCTTCTTCCAATTTCTGTAAAGCAGTGGCAAAACGTTCCTGAGCTCTGTCCAACTCTTCCTCCCCAAGCTGGATACGGCCGTTTAGTGGCACCTACTTCCCCTTCAACATCAATTGCCTTCTTATCCGCTTGTTCAGTTTTCTCCTGAACAATCCCTCAAAACTTCAAAGTAATTTATCCGCCTCAACCTTCGGTTACCTTTCAGCTTTTTTTCGGCCGGGGGCAAAAGGCCCCAATCCCCCCCACTGTGTTTGCCCCTTTGTTCCCCCCCGCCG
Full Trace Sequence: GAAGTGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAAACTGCCCAGTTCTTGTAGTGCCTGATCCAGAACTTGATGCATGCCCAAGTTTTCTTCTTTGGCGCTTGCCAGCTTGTCTTCCAGGTCATCAATTGACTTTTCTAGTTTGGCCACTGTCCTTTCTGCAAATTCAGCCCGGGTTTCAGCCTCTTTAAGTTTGTCTGTTAAAATCTTTATTTCTTCTTCATATTTATCTTCTTTTTCAGAATACTTCTCAGATTGTGCCTCCAAGGATTTTAAGTTGTTAGTCACATTTTTCAGTTCTTCTTCCAAATCACTACATTTGAGTTCGGACACCTCTGCACGCTCCTCTGCTCTTTCAAGTTCTCCCTCAAGAATAACCAGTTTCCGAGCAACCTCTTCATATTTCCGATCTGCATCCTCTGCAATGTGTTTAGCTTCTTTCAGTTGCATTTCTTGAATTTCCATCTTCTCCTCATCCTTCATTGCCCTGTTCTCAATCACCTTCATACCTCTCTCGCTTTCATCAGCTGCTTTCTCCGCTTCTTCCAATTTCTGTAAAGCAGTGGCAAAACGTTCCTGAGCTCTGTCCAACTCTTCCTCCCCAAGCTGGATACGGCCGTTTAGTGGCACCTACTTCCCCTTCAACATCAATTGCCTTCTTATCCGCTTGTTCAGTTTTCTCCTGAACAATCCCTCAAAACTTCAAAGTAATTTATCCGCCTCAACCTTCGGTTACCTTTCAGCTTTTTTTCGGCCGGGGGCAAAAGGCCCCAATCCCCCCCACTGTGTTTGCCCCTTTGTTCCCCCCCGCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAAACTGCCCAGTTCTTGTAG