ORFeome > tprg1l ORF1 – XORFeome v1.0

tprg1l ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tprg1l
Gene ID: 5849128
Gene Page ID: 5849056
ORF Xenbase ID: 17302191

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084375
Original XGC clone length: 816

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: B06

Sequences - 5ʹ (forward) EST

Accession: JZ839955
dbEST ID: 79657657
Trimmed Sequence: ATGCTGCAGCTCAATGACTCCGATACCAGCCCGGCAGCCACTCTGTCACCCGAAGGCGCTGAGGTGGCCGAGGTCCAGCTGAGCCCGGAAAGGGGAGCCTTCGGGACCACGCCCTCTAATTATTCCGTGCAGTCTCTGCACTCTCTCACCGTGCACAACCCCACGCACCAGGCCAGAATCAAAGAGTTCTTCGTATTCAGGCCTGGGAATCTTGAACAAGCAGTAAATGATATACGCATGGTTGTGCTTCCAACAGAGGATGGAGAGATCCAGAGTGTTTGGCTACTTACAGAAGTTGATCACTGGAACAATGAAAAGGAACGGCTGGTTCTTATTACTGAGCGAACACTATTAATTTGCAAATATGATTTCATCTGCATGGAGTGCCAGCAAGTCATCCGAATAGCTCTCAATGCTGTGGACACCATCTCCATAGGAGAATTTGAGTTTCCTCCAATGTCTCTAAACAGACGTGAAGGAACAGGAATTCGCATTCTGTGGAGTACACGGCGCTTCTCTTTCATGAACAAATGGAACCCTTGGACCACCAATATGCCCTACGCTACCTTTATAGAACACCCGATGGCACATGCAGATGACAAAGTCATGCCACTATGCAAGCTGGAGGACTTCAAGACCCACCTGATTCAAGCTGTGAAGAAAGCTCACAACCAAAATCCAGTTCAAGGAAAAACAAATGGGTGGGCTGGGGCC
Full Trace Sequence: GTTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGCAGCTCAATGACTCCGATACCAGCCCGGCAGCCACTCTGTCACCCGAAGGCGCTGAGGTGGCCGAGGTCCAGCTGAGCCCGGAAAGGGGAGCCTTCGGGACCACGCCCTCTAATTATTCCGTGCAGTCTCTGCACTCTCTCACCGTGCACAACCCCACGCACCAGGCCAGAATCAAAGAGTTCTTCGTATTCAGGCCTGGGAATCTTGAACAAGCAGTAAATGATATACGCATGGTTGTGCTTCCAACAGAGGATGGAGAGATCCAGAGTGTTTGGCTACTTACAGAAGTTGATCACTGGAACAATGAAAAGGAACGGCTGGTTCTTATTACTGAGCGAACACTATTAATTTGCAAATATGATTTCATCTGCATGGAGTGCCAGCAAGTCATCCGAATAGCTCTCAATGCTGTGGACACCATCTCCATAGGAGAATTTGAGTTTCCTCCAATGTCTCTAAACAGACGTGAAGGAACAGGAATTCGCATTCTGTGGAGTACACGGCGCTTCTCTTTCATGAACAAATGGAACCCTTGGACCACCAATATGCCCTACGCTACCTTTATAGAACACCCGATGGCACATGCAGATGACAAAGTCATGCCACTATGCAAGCTGGAGGACTTCAAGACCCACCTGATTCAAGCTGTGAAGAAAGCTCACAACCAAAATCCAGTTCAAGGAAAAACAAATGGGTGGGCTGGGGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGCAGCTCAATGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839954
dbEST ID: 79657656
Trimmed Sequence: AAATCCAATTTTGCCTCTTGACATGGCGTATCCTAGTTTGGCCTCATTGTTAATCAAAGACATGAGCCCCAAGTAAGTTTCAATCATAAGAGGGCGCTCCAGCACCAGCACACCATTCGCTTTTCCTTGAACTGGATTTTGCTTGTGAGCTTTCTTCACAGCTTGAATCAGCTGGGTCTTGAAGTCCTCCAGCTTGCATAGTGGCATGACCTTGTCATCTGCATGTGCCATCGGGTGTTCTATAAAGGTAGCGTAGGGCATATTGGTGGTCCAAGGGTTCCATTTGTTCATGAAAGAGAAGCGCCGTGTACTCCACAGAATGCGAATTCCTGTTCCTTCACGTCTGTTTAGAGACATTGGAGGAAACTCAAATTCTCCTATGGAGATGGTGTCCACAGCATTGAGAGCTATTCGGATGACTTGCTGGCACTCCATGCAGATGAAATCATATTTGCAAATTAATAGTGTTCGCTCAGTAATAAGAACCAGCCGTTCCTTTTCATTGTTCCAGTGATCAACTTCTGTAAGTAGCCGAACACTCTGGATCTCTCCATCCTCTGTTGGAAGCAAACCATGCGTATATCAGTTACTGCTTGTTCAAGATTCCCAGGCCTGGATACGAA
Full Trace Sequence: GAGCACTGGTAATCACGACTCACTATNAGGGGATATCAGCTGGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAATCCAATTTTGCCTCTTGACATGGCGTATCCTAGTTTGGCCTCATTGTTAATCAAAGACATGAGCCCCAAGTAAGTTTCAATCATAAGAGGGCGCTCCAGCACCAGCACACCATTCGCTTTTCCTTGAACTGGATTTTGCTTGTGAGCTTTCTTCACAGCTTGAATCAGCTGGGTCTTGAAGTCCTCCAGCTTGCATAGTGGCATGACCTTGTCATCTGCATGTGCCATCGGGTGTTCTATAAAGGTAGCGTAGGGCATATTGGTGGTCCAAGGGTTCCATTTGTTCATGAAAGAGAAGCGCCGTGTACTCCACAGAATGCGAATTCCTGTTCCTTCACGTCTGTTTAGAGACATTGGAGGAAACTCAAATTCTCCTATGGAGATGGTGTCCACAGCATTGAGAGCTATTCGGATGACTTGCTGGCACTCCATGCAGATGAAATCATATTTGCAAATTAATAGTGTTCGCTCAGTAATAAGAACCAGCCGTTCCTTTTCATTGTTCCAGTGATCAACTTCTGTAAGTAGCCGAACACTCTGGATCTCTCCATCCTCTGTTGGAAGCAAACCATGCGTATATCAGTTACTGCTTGTTCAAGATTCCCAGGCCTGGATACGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAATCCAATTTTGCCTCTTGACAT