ORFeome > tpte2 ORF1 – XORFeome v1.0

tpte2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tpte2
Gene ID: 1015887
Gene Page ID: 1015880
ORF Xenbase ID: 17302215

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099069
Original XGC clone length: 1530

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ838369
dbEST ID: 79656071
Trimmed Sequence: ATGTCAAGTGTAACAGACGAGCAGAGGGAAGAACCTTCCATGGTTAATGGGTTCGGCAAGACTGAGGCGAAAGTAATAATTGATAATGGGAAGAATGAAGTGGAAGAGCCAGCGACATGGTGGAACAAACTGAGGAAAGTAATTTCTCCATTTGTGATGTCCTTTGGATTCAGGGTCTTTGGAGTTGTTCTGATCATCGTTGACTTTGTTCTGGTGATTGTGGATCTGTCTGTCATTGACAAAAGCAGAGAGGCCACCACTGCAATATCATCCATTTCTTTAGCCATTTCCTTCTTCTTTCTCATTGATGTGCTTCTACATATCTTCGTAGAAGGGTTCCGTCAGTATTTCAGTTCCAAGCTGAACATATTTGATGCGGCTATTGTTATTGTGACACTGCTTGTCACTCTGGTGTATGCATTCACAGACTTCAGCGGAGCTACTAATATTCCAAGACTGGTAAACTTTCTTCGAGGCTTGAGAATTATCATCTTGGTGAGAATTCTCCGCCTGGCATCTCAGAAGAGGCAACTTGAGAAAGTAACAAGGAGGCTGGTCTCTGAAAACAAAAGACGATATCAAAAGGATGGGTTTGACCTGGATCTCACATATATTACTGATCGTATAATTGCCATGTCCTTTCCATCATCTGGGAAGCAATCGTTTTATAGGAATCCGATTGAGGATGTAGTAAGGTTTTTAGACTCCAGCCATAAGGATCACTACAAAATCT
Full Trace Sequence: GGGGGCCCCAAATAATGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAAGTGTAACAGACGAGCAGAGGGAAGAACCTTCCATGGTTAATGGGTTCGGCAAGACTGAGGCGAAAGTAATAATTGATAATGGGAAGAATGAAGTGGAAGAGCCAGCGACATGGTGGAACAAACTGAGGAAAGTAATTTCTCCATTTGTGATGTCCTTTGGATTCAGGGTCTTTGGAGTTGTTCTGATCATCGTTGACTTTGTTCTGGTGATTGTGGATCTGTCTGTCATTGACAAAAGCAGAGAGGCCACCACTGCAATATCATCCATTTCTTTAGCCATTTCCTTCTTCTTTCTCATTGATGTGCTTCTACATATCTTCGTAGAAGGGTTCCGTCAGTATTTCAGTTCCAAGCTGAACATATTTGATGCGGCTATTGTTATTGTGACACTGCTTGTCACTCTGGTGTATGCATTCACAGACTTCAGCGGAGCTACTAATATTCCAAGACTGGTAAACTTTCTTCGAGGCTTGAGAATTATCATCTTGGTGAGAATTCTCCGCCTGGCATCTCAGAAGAGGCAACTTGAGAAAGTAACAAGGAGGCTGGTCTCTGAAAACAAAAGACGATATCAAAAGGATGGGTTTGACCTGGATCTCACATATATTACTGATCGTATAATTGCCATGTCCTTTCCATCATCTGGGAAGCAATCGTTTTATAGGAATCCGATTGAGGATGTAGTAAGGTTTTTAGACTCCAGCCATAAGGATCACTACAAAATCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAAGTGTAACAGACGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838368
dbEST ID: 79656070
Trimmed Sequence: AGACTCAAAGTTTAACTCCACCGCAAAGTTCTCTTTGTAGATCTTCCCAGATTTTTCTTTGTGGGGATTGTCAAGCTCATTCTTGGAAAGGTAGAGTCTGCTGTTTTCTATGAAGCATGTGTTGAACCAGAAGTAGATGGCACAGTCATCGTAGCCTTTTGGAAGATTCGTGCTGAACTCAAATCTTATTTTAATGTCTCCCGAGATAACTGGAAAACCTTCCAGGCTTAGGACTATGGAGTTGTTTCCAGCATCAAAAAACAGCTTACAGTTTTCCTGTGTCTCACAGACGCACTGGAACACTACTTCTTTCTTCATTATTATCTGAACTTTTAAATCTGTGCCGTTGCTTCTCCCTACACCTTGTATAGAGTGGATTTTGATACTTCTGATCTTGAGTTGTTTCTCTGGAGGAAGTTGGCGGCAGAATTTGTTCTTCAGAACTTCATAGTATGCAACATACCTGCTCTGAGAAGGTGTTTCTACACCCTGGAACTTGGTGCTTACACTTTTATCAGTACGTCTTTCTCCAAAATAATCCAAACTTTCCACAGCACTCTCAAACTGGTCACTGTCCACAGGGTATGTGCAAACCATGGGTCCCGTCCGCCCTTTGCCCCCTTTACATGAAAAACAATAAACATTTGGGGGATCCTCTGCCATCCCTGCCCCGTACACTGGCAGTGAAAGTTCAACAGGGCCCGCCGGCACTGGGGAAAATT
Full Trace Sequence: GGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCACGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGACTCAAAGTTTAACTCCACCGCAAAGTTCTCTTTGTAGATCTTCCCAGATTTTTCTTTGTGGGGATTGTCAAGCTCATTCTTGGAAAGGTAGAGTCTGCTGTTTTCTATGAAGCATGTGTTGAACCAGAAGTAGATGGCACAGTCATCGTAGCCTTTTGGAAGATTCGTGCTGAACTCAAATCTTATTTTAATGTCTCCCGAGATAACTGGAAAACCTTCCAGGCTTAGGACTATGGAGTTGTTTCCAGCATCAAAAAACAGCTTACAGTTTTCCTGTGTCTCACAGACGCACTGGAACACTACTTCTTTCTTCATTATTATCTGAACTTTTAAATCTGTGCCGTTGCTTCTCCCTACACCTTGTATAGAGTGGATTTTGATACTTCTGATCTTGAGTTGTTTCTCTGGAGGAAGTTGGCGGCAGAATTTGTTCTTCAGAACTTCATAGTATGCAACATACCTGCTCTGAGAAGGTGTTTCTACACCCTGGAACTTGGTGCTTACACTTTTATCAGTACGTCTTTCTCCAAAATAATCCAAACTTTCCACAGCACTCTCAAACTGGTCACTGTCCACAGGGTATGTGCAAACCATGGGTCCCGTCCGCCCTTTGCCCCCTTTACATGAAAAACAATAAACATTTGGGGGATCCTCTGCCATCCCTGCCCCGTACACTGGCAGTGAAAGTTCAACAGGGCCCGCCGGCACTGGGGAAAATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACTCAAAGTTTAACTCCACC