ORFeome > traf7 ORF1 – XORFeome v1.0

traf7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: traf7
Gene ID: 949629
Gene Page ID: 949625
ORF Xenbase ID: 17302275

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041725
Original XGC clone length: 2001

Human orthology & disease relationships

NCBI Entrez ID: 84231
Ensembl gene IDs: ENSG00000131653
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 270200,300000,307030

Library Location

Plate ID: GDExl11007
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ823603
dbEST ID: 79641305
Trimmed Sequence: ATGACCTCAAATAAGAATCCGCGCTTTAACCATTTCTCAGCTGGAGCCTCCAATCTTAATTTAACAGAAAACAGCAACGGGACTAGAATGGAGACCACGTTTGGTCCTGCGTTCTCAGCAGTGACAACTATTACCAAAGCTGATGGAACCAAGCACAGACGGACCCCCTCCTCATCCAGTACCCTGACATTTTCCCCCCGGGATGAAGATGATGTTATGCCTCCAATCAGCACCCCGAGACGCTCGGATTCTGCCATTTCTATACGGTCCCTGCATTCGGAGTCCACCATGTCCCTGAGGTCCACGTTCTCGCTCCATGAAGAAGAAGAAGAGCCGGACCCGCTAGTGTTTGCGGAGCAGCCCTCGGTGAAACTCTGTTGTCAGCTCTGCTGCAGCGTCTTTAAAGATCCTGTCATTACCACATGTGGGCATACGTTCTGCAGGAGGTGCGCTCTGACATCTGAAAAGTGTCCGGTGGATAACGCCAAACTAACGGTGGTCGTGAACAACATCGCTGTTGCCGAGCAAATAGGAGAGCTTTTCATTCACTGTAAATATGGCTGCCACCCCTCCTCCAACGGCAAGCCGGCTGTTTTCGAAGTGGATCCTCACGGCTGCCCCTTCACCATTAAATTAAGTGCCAGAAAGGACCATGAAGGGAGCTGCGATTACCGACCGGTCCGTTGTCCTAATAACCCCAATTGCCCCCCCGTTATAAAAGATGAACTTTGGAAGCTCATTTAAAGGAGTGT
Full Trace Sequence: CAGTATTGATTATTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCTCAAATAAGAATCCGCGCTTTAACCATTTCTCAGCTGGAGCCTCCAATCTTAATTTAACAGAAAACAGCAACGGGACTAGAATGGAGACCACGTTTGGTCCTGCGTTCTCAGCAGTGACAACTATTACCAAAGCTGATGGAACCAAGCACAGACGGACCCCCTCCTCATCCAGTACCCTGACATTTTCCCCCCGGGATGAAGATGATGTTATGCCTCCAATCAGCACCCCGAGACGCTCGGATTCTGCCATTTCTATACGGTCCCTGCATTCGGAGTCCACCATGTCCCTGAGGTCCACGTTCTCGCTCCATGAAGAAGAAGAAGAGCCGGACCCGCTAGTGTTTGCGGAGCAGCCCTCGGTGAAACTCTGTTGTCAGCTCTGCTGCAGCGTCTTTAAAGATCCTGTCATTACCACATGTGGGCATACGTTCTGCAGGAGGTGCGCTCTGACATCTGAAAAGTGTCCGGTGGATAACGCCAAACTAACGGTGGTCGTGAACAACATCGCTGTTGCCGAGCAAATAGGAGAGCTTTTCATTCACTGTAAATATGGCTGCCACCCCTCCTCCAACGGCAAGCCGGCTGTTTTCGAAGTGGATCCTCACGGCTGCCCCTTCACCATTAAATTAAGTGCCAGAAAGGACCATGAAGGGAGCTGCGATTACCGACCGGTCCGTTGTCCTAATAACCCCAATTGCCCCCCCGTTATAAAAGATGAACTTTGGAAGCTCATTTAAAGGAGTGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCTCAAATAAGAATCCGC

Sequences - 3ʹ (reverse) EST

Accession: JZ828902
dbEST ID: 79646604
Trimmed Sequence: GCAAGTCCAGACCTTCACTGTACTGTCCACTGCACCAGAGAAGAGGCGACCCCGCGACACTGCCAGAGCCGTGACACTGCCCTGATGTCTCAACAACGTCTGGGTGCAGATCATGTTATCCATACTCCACACCCGCAGTGATCTGTCATACGAGGCGCTGAAAACCTTGGTTTGATCAGGTGTGGATATGACAGCCAGCGCATACACTGTCCCAACATGTCCTGTCAGCGTCCTCATTTGCTCTTTGGATTCAATGTCCCAGACATGTATAAGGTTCTCGTATGTCCCACAGACTATATGGTGGTTGGTTACTGCGATGGAGTACACACTGCCACCTGATGTTTGCAGGACATGGACACATTCCAACGTTCTGATGTCCCAAATCTTGATGGTTTGGTAGGACCCACTGTACAGGTAGTTCTGAGAGGCCACAAGAGCTCGCACCCAGTGGTTTAGGCCTGTAAGCTCCTTCTTCAGTTTCAAGTCTGTGCCCACAATGTCCCACACCTTGATGGCTTTCAGGGAGCCGCTGAACAGCATATTATGCGATGACACTAAGGTGCAAACAGGGTTGTCGTGCGCTCGAATGGTATTAACCTTCAGCAGAGTCTGAATGTCCCACACAATAATAGTGCAGTCTGCTGAACCGCT
Full Trace Sequence: GCTGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAAGTCCAGACCTTCACTGTACTGTCCACTGCACCAGAGAAGAGGCGACCCCGCGACACTGCCAGAGCCGTGACACTGCCCTGATGTCTCAACAACGTCTGGGTGCAGATCATGTTATCCATACTCCACACCCGCAGTGATCTGTCATACGAGGCGCTGAAAACCTTGGTTTGATCAGGTGTGGATATGACAGCCAGCGCATACACTGTCCCAACATGTCCTGTCAGCGTCCTCATTTGCTCTTTGGATTCAATGTCCCAGACATGTATAAGGTTCTCGTATGTCCCACAGACTATATGGTGGTTGGTTACTGCGATGGAGTACACACTGCCACCTGATGTTTGCAGGACATGGACACATTCCAACGTTCTGATGTCCCAAATCTTGATGGTTTGGTAGGACCCACTGTACAGGTAGTTCTGAGAGGCCACAAGAGCTCGCACCCAGTGGTTTAGGCCTGTAAGCTCCTTCTTCAGTTTCAAGTCTGTGCCCACAATGTCCCACACCTTGATGGCTTTCAGGGAGCCGCTGAACAGCATATTATGCGATGACACTAAGGTGCAAACAGGGTTGTCGTGCGCTCGAATGGTATTAACCTTCAGCAGAGTCTGAATGTCCCACACAATAATAGTGCAGTCTGCTGAACCGCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAAGTCCAGACCTTCACTGTA