ORFeome > trappc3 ORF1 – XORFeome v1.0

trappc3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: trappc3
Gene ID: 6253922
Gene Page ID: 1003910
ORF Xenbase ID: 17302323

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053802
Original XGC clone length: 543

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ839501
dbEST ID: 79657203
Trimmed Sequence: ATGTCCCGACAAACCAACAGAGGCACCGAGAGCAAAAAGATGAACTCTGAGCTCTTCACTCTGACATATGGTGCACTCGTCACCCAGTTGTGTAAAGACTATGAAAATGATGAAGATGTCAACAAGCAGCTGGAAAAAATGGGATACAACATAGGTGTGAGACTCATAGAAGATTTTTTGGCACGGTCAAGTATTGGGAGGTGTCATGATTTTCGGGAAACGGCTGATGTTATAGCAAAGGTGGCCTTTAAAATGTACCTGGGGGTCACACCTACTATCACAAATTGGAGTCCAGCAGGAGATGAATTCTCCCTCATCCTGGAGAACAACCCTCTTGTAGACTTTGTTGAGTTGCCAGACAACCATTCCACTCTGGTCTATTCCAACCTGCTATGTGGAGTAATGAGGGGAGCCCTGGAAATGGTTCAAATGGCAGTCGATGTGAAGTTTGTGCAGGATACACTGAAAGGTGATAGCGTGACAGAAATCAGAATGAAGTTCATCAAAAGGATTGAGGATAACCTCCCAGCTGGGGAAGAGTT
Full Trace Sequence: TCGAGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCCGACAAACCAACAGAGGCACCGAGAGCAAAAAGATGAACTCTGAGCTCTTCACTCTGACATATGGTGCACTCGTCACCCAGTTGTGTAAAGACTATGAAAATGATGAAGATGTCAACAAGCAGCTGGAAAAAATGGGATACAACATAGGTGTGAGACTCATAGAAGATTTTTTGGCACGGTCAAGTATTGGGAGGTGTCATGATTTTCGGGAAACGGCTGATGTTATAGCAAAGGTGGCCTTTAAAATGTACCTGGGGGTCACACCTACTATCACAAATTGGAGTCCAGCAGGAGATGAATTCTCCCTCATCCTGGAGAACAACCCTCTTGTAGACTTTGTTGAGTTGCCAGACAACCATTCCACTCTGGTCTATTCCAACCTGCTATGTGGAGTAATGAGGGGAGCCCTGGAAATGGTTCAAATGGCAGTCGATGTGAAGTTTGTGCAGGATACACTGAAAGGTGATAGCGTGACAGAAATCAGAATGAAGTTCATCAAAAGGATTGAGGATAACCTCCCAGCTGGGGAAGAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCACCTGAAATCCCCTAAAATGAGTCGTATTACATGAAAAAAAAAGGTTTTCCGGGCAACTCTGGCCCGTGTCTCAAAACCCCCCGAAAGAAAAAAAAACANGTGCNCGGGNACACGGGGGTCCCCGAAGTAGAAGGTATGAACACAAAAAGAACCCCAACAACCACAGAGACCCCCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCCGACAAACCAACAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839500
dbEST ID: 79657202
Trimmed Sequence: CTCTTCCCCAGCTGGGAGGTTATCCTCAATCCTTTTGATGAACTTCATTCTGATTTCTGTCACGCTATCACCTTTCAGTGTATCCTGCACAAACTTCACATCGACTGCCATTTGAACCATTTCCAGGGCTCCCCTCATTACTCCACATAGCAGGTTGGAATAGACCAGAGTGGAATGGTTGTCTGGCAACTCAACAAAGTCTACAAGAGGGTTGTTCTCCAGGATGAGGGAGAATTCATCTCCTGCTGGACTCCAATTTGTGATAGTAGGTGTGACCCCCAGGTACATTTTAAAGGCCACCTTTGCTATAACATCAGCCGTTTCCCGAAAATCATGACACCTCCCAATACTTGACCGTGCCAAAAAATCTTCTATGAGTCTCACACCTATGTTGTATCCCATTTTTTCCAGCTGCTTGTTGACATCTTCATCATTTTCATAGTCTTTACACAACTGGGTGACGAGTGCACCATATGTCAGAGTGAAGAGCTCATAGTTCATCTTTTTGCTCTCGGGGCCTCTGTTGGTTTGTCGGGACATGG
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCTTCCCCAGCTGGGAGGTTATCCTCAATCCTTTTGATGAACTTCATTCTGATTTCTGTCACGCTATCACCTTTCAGTGTATCCTGCACAAACTTCACATCGACTGCCATTTGAACCATTTCCAGGGCTCCCCTCATTACTCCACATAGCAGGTTGGAATAGACCAGAGTGGAATGGTTGTCTGGCAACTCAACAAAGTCTACAAGAGGGTTGTTCTCCAGGATGAGGGAGAATTCATCTCCTGCTGGACTCCAATTTGTGATAGTAGGTGTGACCCCCAGGTACATTTTAAAGGCCACCTTTGCTATAACATCAGCCGTTTCCCGAAAATCATGACACCTCCCAATACTTGACCGTGCCAAAAAATCTTCTATGAGTCTCACACCTATGTTGTATCCCATTTTTTCCAGCTGCTTGTTGACATCTTCATCATTTTCATAGTCTTTACACAACTGGGTGACGAGTGCACCATATGTCAGAGTGAAGAGCTCATAGTTCATCTTTTTGCTCTCGGGGCCTCTGTTGGTTTGTCGGGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTTATAAAAACCATTGCTCATCAAATTGTTGCACCAAACAGGTCACTATCAGTCAAAATAAAACCAATAAAAAAAAAAAAAAAGAGAAAACGGGCCGTCGGTTTCCCGACCCCGAGGAATGAAAAAAAGCCCCCGGGCTCTCTGGACAACGGGGGTCTTGGGGGTGACACTGGTGGTGGAGGGGGAGAAAGCCGCCCAACAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTTCCCCAGCTGGGAGGT