ORFeome > trdmt1 ORF1 – XORFeome v1.0

trdmt1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: trdmt1
Gene ID: 946303
Gene Page ID: 946297
ORF Xenbase ID: 17302359

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC046854
Original XGC clone length: 1149

Human orthology & disease relationships

NCBI Entrez ID: 1787
Ensembl gene IDs: ENSG00000107614
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 177200,219700,264350

Library Location

Plate ID: GDExl11014
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ824203
dbEST ID: 79641905
Trimmed Sequence: ATGCACTGCGGCCTAGCAGAAAGTGGTGTAGCTGCTGAAGTTGTGGCTGCAGTGGATGTGAATACCAATGCCAATAAAGTCTACAAATATAACTTTCCCCATACTCCTTTATGGCCAAAGACTATTGAGGGAATAACACTGAAAGAGCTTGATGCTTTGTCTTTTGATATGATCCTTATGAGTCCTCCTTGCCAGCCATTCACAAGGATAGGCCTGCAGGGTGACATTTCTGATCCAAGAGCAAAGAGCTTCCTTTATGTTCTTGACATACTTCCAAGGCTGAAGAAACTCCCTGCGTATATTCTGTTAGAGAATGTAAAAGGATTTGAATCATCTGAAGCCAGGGAAGCCTTGATTGGAACATTGCAAAAGTGCGGATATGTCTACCAAGAGTTCCTGCTGTCACCGACGTGTCTTGGGATTCCTAATTCTAGACTGCGCTACTTTCTGATTGCAAAGCTACAAACTGAACCGTTTGCTTTCCCAATCTCCAATACAATTCTTGAAGAGTTTCCAAGCCAGCACTCAATTGACCCTGGAAGAAGGAGGGTTATTCATTGTTCAGAAAATAACCCACAAGCAGGTGCGGATCAGAAAAATCCAAGTTGCCCTTTTAGCGGCACTGATCATGGCCCTGAAAAGACCTTTCTTTACAAGCTGGAGACTGCTCAAGAGCTGGAGAGAAAACTAGGCCAGGACAATGACGCCTTCTGTTAGAAATGTGCAAGACTTTCTCGAGACGAGTGTCGAGGAAAATGAACCAGTATTTTCTGGCCCCCAAAGTCTTTATTGCCAAAATGCTTTGGAATTCTTGAACAATTTTAAGAACCCCACTGTCCAAA
Full Trace Sequence: GCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCACTGCGGCCTAGCAGAAAGTGGTGTAGCTGCTGAAGTTGTGGCTGCAGTGGATGTGAATACCAATGCCAATAAAGTCTACAAATATAACTTTCCCCATACTCCTTTATGGCCAAAGACTATTGAGGGAATAACACTGAAAGAGCTTGATGCTTTGTCTTTTGATATGATCCTTATGAGTCCTCCTTGCCAGCCATTCACAAGGATAGGCCTGCAGGGTGACATTTCTGATCCAAGAGCAAAGAGCTTCCTTTATGTTCTTGACATACTTCCAAGGCTGAAGAAACTCCCTGCGTATATTCTGTTAGAGAATGTAAAAGGATTTGAATCATCTGAAGCCAGGGAAGCCTTGATTGGAACATTGCAAAAGTGCGGATATGTCTACCAAGAGTTCCTGCTGTCACCGACGTGTCTTGGGATTCCTAATTCTAGACTGCGCTACTTTCTGATTGCAAAGCTACAAACTGAACCGTTTGCTTTCCCAATCTCCAATACAATTCTTGAAGAGTTTCCAAGCCAGCACTCAATTGACCCTGGAAGAAGGAGGGTTATTCATTGTTCAGAAAATAACCCACAAGCAGGTGCGGATCAGAAAAATCCAAGTTGCCCTTTTAGCGGCACTGATCATGGCCCTGAAAAGACCTTTCTTTACAAGCTGGAGACTGCTCAAGAGCTGGAGAGAAAACTAGGCCAGGACAATGACGCCTTCTGTTAGAAATGTGCAAGACTTTCTCGAGACGAGTGTCGAGGAAAATGAACCAGTATTTTCTGGCCCCCAAAGTCTTTATTGCCAAAATGCTTTGGAATTCTTGAACAATTTTAAGAACCCCACTGTCCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCACTGCGGCCTAGCAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829508
dbEST ID: 79647210
Trimmed Sequence: GGGAGACTGAAGCAGAAGGCTGATGAGACTGGAGACAATATGTACATTGAGACTGTTCCCAAGCAGCCGATAACGTTGTTTTGTTGTTACCTCTTCGGGAAAACCAAATGTTTCTGGAAATCCATGAAGATTTGCGATCTCTCTAGGGGTAAAATACCGCATTTTTAGTGAGGACAACTTTGCAAGCTTCTCCTCTTCATTCAGCAATTCCAGTGAATTATAAACAGAATCAATCTCAACATCAGTAGCTGTCTGAAGAACAGAGCCTGTACCTTCAACATAATGCCCATATCCTTTGGTAAAGCAAGTCGATCTTCTGCATGTGGGTCTTACAATGTCCAGAATCAAAGCATATCGCAATAAAGACTTTGGGGGCAGAAAATACTGGCTCATCTCCTCGACACTCGTCTCGAGAAAGTCTTGCAACATTCTAACAGAGGCGTCATTGTCCTGGCCTTGTTTTCTCTCCAGCTCTTGAGCAGTCTCCAGCTTGTAAAGAAAGGTCTTTTCAGGGCCATGATCAGTGCCGCTAAAAGGGCAACTTGGATTTTTCTGATCCGCACCTGCTTGTGGGTTATTTTCTGAACAATGAATAACCCTCCTTCTTCCAGGGTCAATTGAGTGCTGGCTTGGAAACTCTTCAAGAATTGTATTGGAGATTGGGAAAACCAACCGGTTCAGTTTGTAGCTTTTGCAATCGAAAAGTTACCGCAGTTCTAGAATTAGGAAAACCCCCAAAAAAACGTTCGGGGTGAC
Full Trace Sequence: GCGACAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGGAGACTGAAGCAGAAGGCTGATGAGACTGGAGACAATATGTACATTGAGACTGTTCCCAAGCAGCCGATAACGTTGTTTTGTTGTTACCTCTTCGGGAAAACCAAATGTTTCTGGAAATCCATGAAGATTTGCGATCTCTCTAGGGGTAAAATACCGCATTTTTAGTGAGGACAACTTTGCAAGCTTCTCCTCTTCATTCAGCAATTCCAGTGAATTATAAACAGAATCAATCTCAACATCAGTAGCTGTCTGAAGAACAGAGCCTGTACCTTCAACATAATGCCCATATCCTTTGGTAAAGCAAGTCGATCTTCTGCATGTGGGTCTTACAATGTCCAGAATCAAAGCATATCGCAATAAAGACTTTGGGGGCAGAAAATACTGGCTCATCTCCTCGACACTCGTCTCGAGAAAGTCTTGCAACATTCTAACAGAGGCGTCATTGTCCTGGCCTTGTTTTCTCTCCAGCTCTTGAGCAGTCTCCAGCTTGTAAAGAAAGGTCTTTTCAGGGCCATGATCAGTGCCGCTAAAAGGGCAACTTGGATTTTTCTGATCCGCACCTGCTTGTGGGTTATTTTCTGAACAATGAATAACCCTCCTTCTTCCAGGGTCAATTGAGTGCTGGCTTGGAAACTCTTCAAGAATTGTATTGGAGATTGGGAAAACCAACCGGTTCAGTTTGTAGCTTTTGCAATCGAAAAGTTACCGCAGTTCTAGAATTAGGAAAACCCCCAAAAAAACGTTCGGGGTGAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGAGACTGAAGCAGAAGGCTGA