ORFeome > trib2 ORF1 – XORFeome v1.0

trib2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: trib2
Gene ID: 865865
Gene Page ID: 489425
ORF Xenbase ID: 17302383

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC082932
Original XGC clone length: 489

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ839749
dbEST ID: 79657451
Trimmed Sequence: ATGAACATACAAAGGTCGAACCCCATTACAATCGCAAGGTATGGGAGATCGAGGAATAAAAACCAGGATTTCGAAGAGCTATCGTCCATAAGGTCCACAGAGCCCAGTCAGAGCTTCAGCCCAAACCTTGGCTCTCCAAGTCCCCCAGAGACTCCGAACTCGTCGCATTGCGTTTCCTGCATTGGGAAATACTTATTGTTGGAGCCTCTGGAGGGAAACCACGTTTTCCGAGCCCTTCATCTGCACAGCGGAGAGGAGTTTCTGTGCAAGGTTTTCGATATTCGCTGCTACCAGGAGACGCTGGCACCTTGTTTTTGCCTACCTATCCACCACAACATTAACCAAATAGCCGAAATCATCCTCGGAGAGATTAAAGCTTATGTGTTCTTCGAGCGCAGCCATGGGGATATGCATTCTTTTGTCCGTACCTGCAAAAAGCTGAAGAGGAGGAAGCTGCCAGACTGTTTTATCAGATTGTATCGGCTGTT
Full Trace Sequence: GGGGTTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACATACAAAGGTCGAACCCCATTACAATCGCAAGGTATGGGAGATCGAGGAATAAAAACCAGGATTTCGAAGAGCTATCGTCCATAAGGTCCACAGAGCCCAGTCAGAGCTTCAGCCCAAACCTTGGCTCTCCAAGTCCCCCAGAGACTCCGAACTCGTCGCATTGCGTTTCCTGCATTGGGAAATACTTATTGTTGGAGCCTCTGGAGGGAAACCACGTTTTCCGAGCCCTTCATCTGCACAGCGGAGAGGAGTTTCTGTGCAAGGTTTTCGATATTCGCTGCTACCAGGAGACGCTGGCACCTTGTTTTTGCCTACCTATCCACCACAACATTAACCAAATAGCCGAAATCATCCTCGGAGAGATTAAAGCTTATGTGTTCTTCGAGCGCAGCCATGGGGATATGCATTCTTTTGTCCGTACCTGCAAAAAGCTGAAGAGGAGGAAGCTGCCAGACTGTTTTATCAGATTGTATCGGCTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCCTGTTACAAGAAAGCTCTGGCCCGTGTCTCAATCCCCTTAAAGGTTACAAGNGGNNTTNTATTTTCCGCCTGGTTGCGTTCGCAGGGGTGGGCGGTGTCTTTCCTTTCGTGTGAGGTGGCGGGGAGGCTCCCTCTCCAGGCAAGAAACCCCCGGCGGGGGGGTGGTTAAAATATGAAAAAAAAAAAAAAACAGCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACATACAAAGGTCGAACCC

Sequences - 3ʹ (reverse) EST

Accession: JZ839748
dbEST ID: 79657450
Trimmed Sequence: CAGCCGATACAATCTGATAAAACAGTCTGGCAGCTTCCTCCTCTTCAGCTTTTTGCAGGTACGGACAAAAGAATGCATATCCCCATGGCTGCGCTCGAAGAACACATAAGCTTTAATCTCTCCGAGGATGATTTCGGCTATTTGGTTAATGTTGTGGTGGATAGGTAGGCAAAAACAAGGTGCCAGCGTCTCCTGGTAGCAGCGAATATCGAAAACCTTGCACAGAAACTCCTCTCCGCTGTGCAGATGAAGGGCTCGGAAAACGTGGTTTCCCTCCAGAGGCTCCAACAATAAGTATTTCCCAATGCAGGAAACGCAATGCGACGAGTTCGGAGTCTCTGGGGGACTTGGAGAGCCAAGGTTTGGGCTGAAGCTCTGACTGGGCTCTGTGGACCTTATGGACGATAGCTCTTCGAAATCCTGGTTTTTATTCCTCGATCTCCCATACCTTGCGATTGTAATGGGGTTCGACCTTTGTATGTTCATGG
Full Trace Sequence: GGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGCCGATACAATCTGATAAAACAGTCTGGCAGCTTCCTCCTCTTCAGCTTTTTGCAGGTACGGACAAAAGAATGCATATCCCCATGGCTGCGCTCGAAGAACACATAAGCTTTAATCTCTCCGAGGATGATTTCGGCTATTTGGTTAATGTTGTGGTGGATAGGTAGGCAAAAACAAGGTGCCAGCGTCTCCTGGTAGCAGCGAATATCGAAAACCTTGCACAGAAACTCCTCTCCGCTGTGCAGATGAAGGGCTCGGAAAACGTGGTTTCCCTCCAGAGGCTCCAACAATAAGTATTTCCCAATGCAGGAAACGCAATGCGACGAGTTCGGAGTCTCTGGGGGACTTGGAGAGCCAAGGTTTGGGCTGAAGCTCTGACTGGGCTCTGTGGACCTTATGGACGATAGCTCTTCGAAATCCTGGTTTTTATTCCTCGATCTCCCATACCTTGCGATTGTAATGGGGTTCGACCTTTGTATGTTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCCAAAATAAATCATTAATTTGAAGAAAAAAATAAAAATAAGCGTCATTTAAACAATCAGTTGAATGGGGCGGGGAGAAAAACCCCCNCGTTCCCGCCCCCAAGGTTGGGCGTTGTGTTTAACTTTGGTGGAGCGGAGAGAGAGGCCTCCCCGGGGGAGAGAACCCTGGGGGAGAGAGATGAGTAATATATGAGAGGAAAGGAAGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGCCGATACAATCTGATAAAAC