ORFeome > trim29 ORF1 – XORFeome v1.0

trim29 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: trim29
Gene ID: 865925
Gene Page ID: 490035
ORF Xenbase ID: 17302425

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044714
Original XGC clone length: 1494

Human orthology & disease relationships

NCBI Entrez ID: 23650
Ensembl gene IDs: ENSG00000137699
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 131760,131800,131900,131960,179850,609040,609352

Library Location

Plate ID: GDExl11017
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ824377
dbEST ID: 79642079
Trimmed Sequence: ATGGAAGAACAAGACACCAACAAACCCAATGGTTCAATTTCTGAAGAAGCCAATGGCAGTTTCCACCTTGAATCTCCAAATATAAGTATTATTGATGATAAGGACATTCAGAATGGACCTGGCTTTGATCAAGGCAGTACAAAAACAATCCTGAAAACCAGCATAAGCCCAGGAGGAGTAAAGGGTGGCAAAGTGAGTTTTGGCACTGAGAGTACTGAAGTTAGGCACTCTGACCGTACAAGTACTAGCTCTAACATAGAACCTGATGATGTTCTGTGTGATTCGTGCATTGATGATAAGAAGAAGGCTGTTAGGTCTTGCCTGGTCTGTCAGACATCCTTCTGTGAAACCCATCTCAAGCCCCATTTGGAGGGTGCAGCTTTCCGTGACCATAAGCTTTTGGAACCCATTAGTGACTTTGAGGCCAGAAAATGTCAGCTCCACAGCAAAACAATGGAGCTGTTTTGTCAAACTGACCAAACTTGCATATGCTACCTTTGTATGTTCCAAGAGCATAAGAACCATACCACAGTGACTGTAGAAGCTGAGAAGTACGTTAAGGAGACAGAGCTGTCGGAAATTCAAGAACAGCTTCACCTTCAGATCCTTGATGTGGATGATGAAGTAGAGAGATGGCAGAAAGAGAAAGACGCATAANNGATTTCACACCAACCAAAAGTCAGCTGTGGATCACTGCTTCAAAGATTTAATAAGAGAGCTTCAAGACAAAAGGGGGGAAGGGGAAGGCTCAGCTGGAGCAAAAGAAGGATGCCATAAACCTGGTTAAAAAAAAAAGGGGGTGACTTAAAATGA
Full Trace Sequence: AATTGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGAACAAGACACCAACAAACCCAATGGTTCAATTTCTGAAGAAGCCAATGGCAGTTTCCACCTTGAATCTCCAAATATAAGTATTATTGATGATAAGGACATTCAGAATGGACCTGGCTTTGATCAAGGCAGTACAAAAACAATCCTGAAAACCAGCATAAGCCCAGGAGGAGTAAAGGGTGGCAAAGTGAGTTTTGGCACTGAGAGTACTGAAGTTAGGCACTCTGACCGTACAAGTACTAGCTCTAACATAGAACCTGATGATGTTCTGTGTGATTCGTGCATTGATGATAAGAAGAAGGCTGTTAGGTCTTGCCTGGTCTGTCAGACATCCTTCTGTGAAACCCATCTCAAGCCCCATTTGGAGGGTGCAGCTTTCCGTGACCATAAGCTTTTGGAACCCATTAGTGACTTTGAGGCCAGAAAATGTCAGCTCCACAGCAAAACAATGGAGCTGTTTTGTCAAACTGACCAAACTTGCATATGCTACCTTTGTATGTTCCAAGAGCATAAGAACCATACCACAGTGACTGTAGAAGCTGAGAAGTACGTTAAGGAGACAGAGCTGTCGGAAATTCAAGAACAGCTTCACCTTCAGATCCTTGATGTGGATGATGAAGTAGAGAGATGGCAGAAAGAGAAAGACGCATAANNGATTTCACACCAACCAAAAGTCAGCTGTGGATCACTGCTTCAAAGATTTAATAAGAGAGCTTCAAGACAAAAGGGGGGAAGGGGAAGGCTCAGCTGGAGCAAAAGAAGGATGCCATAAACCTGGTTAAAAAAAAAAGGGGGTGACTTAAAATGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGAACAAGACACCAACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829736
dbEST ID: 79647438
Trimmed Sequence: CGGCGAGTCAGTATTTGCTGCATTACCCTTGTTAACATAGAAAGGGCGTTGTTGGGTCAAAAGGGTCGGCTTAGCTGATTTCCATGTTTGGGGCAAGGACTTATTTGGCTGGTGCCTTGTCATCATTGGATACATGTTCATGTTATAAAGGTTGCCGTCTGGCACAGTGCTGGTGTCTGTGGATGTCACATTAGAGGAGAACTGGTATGCTGAGACCTGAGGGCTGCCTTTTTGTGTAAACATGGAATTCATTGATGTAGCAGAACTGTCAGTTAAGTTCCGTCCGGCAGCGGGCGATTGGAACGATGGCCGGCCACCTCCTTTCATATTAAAAAGTGCACCAAACCTTCCATAGTCAGAAGTCGGGGCCCAGTCTGTTGTAAGGTCTTTCATCATGTACCTATTCTCGACATTCTTTTCAACCAAGTTCTTTGGTCCCTCATTCTTGCTGTATTTCTCCACATGCTTCCTGCCGTTTGTCACTAGTTCCTCTTTCAAACTGCCCATGGCTTGGGTCACCTTTTCTCCATCCAATGTCACTGTGTATGTAGGCAATGGAGGGAATGGGGGGAGCATTTCTGATCACCACCTGAAACTCCTGCAAAAACAGTACAGCATCAGTGGTACGAAGAAGTGTATCTCCATCATGTTGCTTATCTTGCAGCCTGATCGCGTTTTCACTTGTAGGTCACCCACTATCTGCTCCAACAGGGTCCATGGCAATCCCTTTCTTTTTTGCCCCCGCCTAAACCCTTCCCCCTCCCCCCG
Full Trace Sequence: TGCCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGGCGAGTCAGTATTTGCTGCATTACCCTTGTTAACATAGAAAGGGCGTTGTTGGGTCAAAAGGGTCGGCTTAGCTGATTTCCATGTTTGGGGCAAGGACTTATTTGGCTGGTGCCTTGTCATCATTGGATACATGTTCATGTTATAAAGGTTGCCGTCTGGCACAGTGCTGGTGTCTGTGGATGTCACATTAGAGGAGAACTGGTATGCTGAGACCTGAGGGCTGCCTTTTTGTGTAAACATGGAATTCATTGATGTAGCAGAACTGTCAGTTAAGTTCCGTCCGGCAGCGGGCGATTGGAACGATGGCCGGCCACCTCCTTTCATATTAAAAAGTGCACCAAACCTTCCATAGTCAGAAGTCGGGGCCCAGTCTGTTGTAAGGTCTTTCATCATGTACCTATTCTCGACATTCTTTTCAACCAAGTTCTTTGGTCCCTCATTCTTGCTGTATTTCTCCACATGCTTCCTGCCGTTTGTCACTAGTTCCTCTTTCAAACTGCCCATGGCTTGGGTCACCTTTTCTCCATCCAATGTCACTGTGTATGTAGGCAATGGAGGGAATGGGGGGAGCATTTCTGATCACCACCTGAAACTCCTGCAAAAACAGTACAGCATCAGTGGTACGAAGAAGTGTATCTCCATCATGTTGCTTATCTTGCAGCCTGATCGCGTTTTCACTTGTAGGTCACCCACTATCTGCTCCAACAGGGTCCATGGCAATCCCTTTCTTTTTTGCCCCCGCCTAAACCCTTCCCCCTCCCCCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGGCGAGTCAGTATTTGCTGCATT