ORFeome > trim72 ORF1 – XORFeome v1.0

trim72 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: trim72
Gene ID: 5896500
Gene Page ID: 5896446
ORF Xenbase ID: 17302473

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056854
Original XGC clone length: 1434

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: B09

Sequences - 5ʹ (forward) EST

Accession: JZ839541
dbEST ID: 79657243
Trimmed Sequence: ATGTCGACTCCGCAACTGATGCAAGGAATGCAGAAGGACCTCACGTGTCAGCTGTGTCTTGAGCTGTTCCGAGCCCCTGTCACACCTGAGTGTGGTCACACCTTCTGCCAGGGCTGCTTGACTGGAGTTCCGAAGAACCAAGACCAAAATGGATCAACACCATGTCCAACTTGCCAGAGCCCCTCTCGCCCAGAGACCCTTCAGATCAACCGTCAACTGGAACACCTTGTCCAAAGCTTTAAGCAGGTCCCACAAGGCCACTGTCTGGAGCACATGGACCCCCTGAGTGTCTACTGTGAGCAAGACAAGGAGCTTATCTGCGGGGTGTGCGCCTCACTCGGCAAGCACAAGGGCCACAATATTATCACAGCTTCTGAGGCCTTTGCCAAGCTGAAGAGGCAGCTTCCCCAGCAACAAGTTATCTTGCAGGAGGCACGACTAAAGAAAGAGAAGACGGTGGCTGTGTTAGACAGACAGGTGGCTGAAGTACAGGACACAGTGTCTCGCTTTAAGGGCAATGTGAAGCATCAGCTCAATGCCATGCGCTCCTACCTGAACATAATGGAAGCCTCACTTGGCAAGGAAGCTGACAAAGCTGAAAGTGCGGCCACAGAAGCTCTGCTTTGTAGAAGGAAGACTATGGGCCATTACCTGGATCAGCTCGGCAGGATGGAANGAGTTCTGAAAGGGATGTGGGAAGCCAGGAAGCAACTGAATTTCTCAGGAAAATACTGTGTGGTTGGCAGCCAGGGTTGAACAAGATTTTATCTGAATCCCCTTTCCTCCGGTTCGTCTGGAAACTCAGCCTTCCCTTTCCACCCCCAATAAATTA
Full Trace Sequence: GGCCACCAAATAATAGAATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGACTCCGCAACTGATGCAAGGAATGCAGAAGGACCTCACGTGTCAGCTGTGTCTTGAGCTGTTCCGAGCCCCTGTCACACCTGAGTGTGGTCACACCTTCTGCCAGGGCTGCTTGACTGGAGTTCCGAAGAACCAAGACCAAAATGGATCAACACCATGTCCAACTTGCCAGAGCCCCTCTCGCCCAGAGACCCTTCAGATCAACCGTCAACTGGAACACCTTGTCCAAAGCTTTAAGCAGGTCCCACAAGGCCACTGTCTGGAGCACATGGACCCCCTGAGTGTCTACTGTGAGCAAGACAAGGAGCTTATCTGCGGGGTGTGCGCCTCACTCGGCAAGCACAAGGGCCACAATATTATCACAGCTTCTGAGGCCTTTGCCAAGCTGAAGAGGCAGCTTCCCCAGCAACAAGTTATCTTGCAGGAGGCACGACTAAAGAAAGAGAAGACGGTGGCTGTGTTAGACAGACAGGTGGCTGAAGTACAGGACACAGTGTCTCGCTTTAAGGGCAATGTGAAGCATCAGCTCAATGCCATGCGCTCCTACCTGAACATAATGGAAGCCTCACTTGGCAAGGAAGCTGACAAAGCTGAAAGTGCGGCCACAGAAGCTCTGCTTTGTAGAAGGAAGACTATGGGCCATTACCTGGATCAGCTCGGCAGGATGGAANGAGTTCTGAAAGGGATGTGGGAAGCCAGGAAGCAACTGAATTTCTCAGGAAAATACTGTGTGGTTGGCAGCCAGGGTTGAACAAGATTTTATCTGAATCCCCTTTCCTCCGGTTCGTCTGGAAACTCAGCCTTCCCTTTCCACCCCCAATAAATTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGACTCCGCAACTGATGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839540
dbEST ID: 79657242
Trimmed Sequence: TAGCTGTTCAGCTGGGGGGTAGAAGATCTTCAGGGGCTGTGAGTTCTTTCCTTTATCATGCCAGCAGACATCAAAGAAGGGATGGAGTCGACCGGAGAAACGCTCATTGAAGGTGTAGAGGAGCTTGAGGTTGTCTTCATCGCTTGAATCAAAGAAGGACACCACCCCATCTGAGAAGCTGAGATAGACTCCTATCTTTTCTGGGCGGCCTTCTACACGCAGGACACGTGGCTCCTTCTGTTCTGTATGGGCCTCATATACTTTCCCCTCCTTACAGCCAATGATCCAGAAGCCATTGGAAGGAGTGGCGTGAAGCTTGCCCTTACGGTTGGCAGTCTCAGAGATGATACCCAATGCCCAACGTGGCTTGTCCTCTACTATGACCTCCCAGTAGTGCTCCCCTTCTGTGAAGCTCTGTTTGCTCACTAGGCAGTTGCTTTTGTCGAAGCGGTTGGGTTCATCGGACACCGATTGCTTTTGGTCCGCGCACTCTACAGATTTGCCTTCTGAGGAAACCACCAAGTACTGCTGGGCTGTGTCTGGGTCAAATGTCATGTTCTCCAGTGCTGGCATCAGGGCTCTAAACATTTTCCTCCATACTTGGAATTTAAACTCATCTGAAATGATGGGGAGCTGGATGTCCAGACGACCAGGAAGAAGGGGATTCCGAATAAAATCTTGGTTCAACCTTCCTGCCCCCACACAGAAATTCCTGGAAGAATTTCAGTTTGGCCTCCTGGCCTTTTCGCGTTCCCGTTCAAAAAACCCCT
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAGCTGTTCAGCTGGGGGGTAGAAGATCTTCAGGGGCTGTGAGTTCTTTCCTTTATCATGCCAGCAGACATCAAAGAAGGGATGGAGTCGACCGGAGAAACGCTCATTGAAGGTGTAGAGGAGCTTGAGGTTGTCTTCATCGCTTGAATCAAAGAAGGACACCACCCCATCTGAGAAGCTGAGATAGACTCCTATCTTTTCTGGGCGGCCTTCTACACGCAGGACACGTGGCTCCTTCTGTTCTGTATGGGCCTCATATACTTTCCCCTCCTTACAGCCAATGATCCAGAAGCCATTGGAAGGAGTGGCGTGAAGCTTGCCCTTACGGTTGGCAGTCTCAGAGATGATACCCAATGCCCAACGTGGCTTGTCCTCTACTATGACCTCCCAGTAGTGCTCCCCTTCTGTGAAGCTCTGTTTGCTCACTAGGCAGTTGCTTTTGTCGAAGCGGTTGGGTTCATCGGACACCGATTGCTTTTGGTCCGCGCACTCTACAGATTTGCCTTCTGAGGAAACCACCAAGTACTGCTGGGCTGTGTCTGGGTCAAATGTCATGTTCTCCAGTGCTGGCATCAGGGCTCTAAACATTTTCCTCCATACTTGGAATTTAAACTCATCTGAAATGATGGGGAGCTGGATGTCCAGACGACCAGGAAGAAGGGGATTCCGAATAAAATCTTGGTTCAACCTTCCTGCCCCCACACAGAAATTCCTGGAAGAATTTCAGTTTGGCCTCCTGGCCTTTTCGCGTTCCCGTTCAAAAAACCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGCTGTTCAGCTGGGGGGT