ORFeome > trim8 ORF1 – XORFeome v1.0

trim8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: trim8
Gene ID: 1006792
Gene Page ID: 1006786
ORF Xenbase ID: 17302479

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC154976
Original XGC clone length: 1656

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: F11

Sequences - 5ʹ (forward) EST

Accession: JZ839028
dbEST ID: 79656730
Trimmed Sequence: ATGGCTGAAAATTGGAAAAACTGTTTTGAGGAGGAGCTTATTTGTCCCATTTGTCTGCATGTTTTTATTGAACCTGTCCAACTCCCTTGTAAGCACAATTTTTGCCGAGGGTGTATCAGCGAGGCCTGGGCTAAAGAGACTGGCATGGTTAGGTGCCCAGAGTGCAACCAAGCCTACAATCAGAAACCCACCCTTGAGAAGAACCTGAAACTCACAAACATTGTAGAAAAGTTCAACTCTCTAAATGTGGATAGAGCACCTTCCATACTGCACTGCGTGTTCTGTAGGAGGGGGCCGCCTCTTCCTGCTCAGAAGATCTGTCTAAGGTGTGAAGCCCCTTGCTGCCAGTCTCACGTGCAGACCCACCTACAGCAGCCGTCCACAGCTCGTGGACACCTTTTGGTGGAAGCAGAAGATGTCAGGGCCTGGAGTTGTCCCCAACACAATGCCTATCGACTGTACCACTGTGACGCAGAACAGGTGGCCGTATGCCAGTTCTGCTGTTACTACAGTGGAGCCCACCAGGGACATTCTGTATGTGATGTGGAGATACGACGGAACGAAATAAGAAAGATGCTGATCAAGCAGCAGGACCGACTGGAAGAAAGGGAGCAGGATATTGAAGACCAGCTGTATAAACTGAAATCTGACAAGAGACTGGTTTGAAGAAAAATCAGCCAGCTGAAAGACAAGGTGCGCCAGCCGTACGATAAACTGCACCAAATTTTGGATAAGGATCTCCGGAAAACAATGGAAAATTCTTGAACAAGCCCCAGCCCCAGTTTTTGCACATTAAAAATTCCAACCAAAAATTTCCCC
Full Trace Sequence: CCGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGAAAATTGGAAAAACTGTTTTGAGGAGGAGCTTATTTGTCCCATTTGTCTGCATGTTTTTATTGAACCTGTCCAACTCCCTTGTAAGCACAATTTTTGCCGAGGGTGTATCAGCGAGGCCTGGGCTAAAGAGACTGGCATGGTTAGGTGCCCAGAGTGCAACCAAGCCTACAATCAGAAACCCACCCTTGAGAAGAACCTGAAACTCACAAACATTGTAGAAAAGTTCAACTCTCTAAATGTGGATAGAGCACCTTCCATACTGCACTGCGTGTTCTGTAGGAGGGGGCCGCCTCTTCCTGCTCAGAAGATCTGTCTAAGGTGTGAAGCCCCTTGCTGCCAGTCTCACGTGCAGACCCACCTACAGCAGCCGTCCACAGCTCGTGGACACCTTTTGGTGGAAGCAGAAGATGTCAGGGCCTGGAGTTGTCCCCAACACAATGCCTATCGACTGTACCACTGTGACGCAGAACAGGTGGCCGTATGCCAGTTCTGCTGTTACTACAGTGGAGCCCACCAGGGACATTCTGTATGTGATGTGGAGATACGACGGAACGAAATAAGAAAGATGCTGATCAAGCAGCAGGACCGACTGGAAGAAAGGGAGCAGGATATTGAAGACCAGCTGTATAAACTGAAATCTGACAAGAGACTGGTTTGAAGAAAAATCAGCCAGCTGAAAGACAAGGTGCGCCAGCCGTACGATAAACTGCACCAAATTTTGGATAAGGATCTCCGGAAAACAATGGAAAATTCTTGAACAAGCCCCAGCCCCAGTTTTTGCACATTAAAAATTCCAACCAAAAATTTCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGAAAATTGGAAAAACTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839027
dbEST ID: 79656729
Trimmed Sequence: ACTGGTGACATAGTGCTTGGCGGCAGGCTGCCCATACACCCTATAGAAGTCTTGGCGGCCATGCTGTTGGGAAGCATCAATCCATTCTCTGACAGCAAGTCCTGGAAGCGACTGAGTTACTGAAGGGGTGGGAGGAAGAGGATGAGAGTATTCCTGGGAAGAGACTGTCCAGGGGAAGTGGCCAGACCTAGGGTAGGGCTGATGGCCACTATGGTTGGACACAGAGGAACAATAACAGTTGTCCACAGAGCAGACCACAATCTTACGCCCTCCATACTGGGAGAGCACAGACTGTTGAGATGATGTGCTGTTGGGGTAATGGGATGGATTGAAGACAGAATTAGAGTGGACTGGCTGGGGGCCACTGGGAAGTCCAACTATGTGCTGGGTGGAGCTGCAAGGCACCATGGGTTGTGCAGACTGGCCCTCACCAGAGGAAAAACCCTGGTTTATGTACTGGCCACTAACAGTTCCCGATGCGGAGTCAAGGAAGTTGCCCTCCTGGAAAAGCAGCTGAATGCTTGCGTTTCTCTGCACCCGAACTGCCTCCACTGCAAGAATACATTGGGATGCTCTGTAAAACCGCCCTGGGGGTGGTGAAGGAACCTACCAGCATCGTTCCGCAAATGCTTCCTCCTTCTTGTCCATTCTCGGTGCGGGAAAAACCTTGGAATTCAAGGTTGCCCAATTTTTTGGGAAGGAAGAGAGGGGAGGGCGCCGGAGGGGACAATTTTCCTAAGGTGCCGGGGCCCACCCCAAGGA
Full Trace Sequence: GGGAAAATGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTGGTGACATAGTGCTTGGCGGCAGGCTGCCCATACACCCTATAGAAGTCTTGGCGGCCATGCTGTTGGGAAGCATCAATCCATTCTCTGACAGCAAGTCCTGGAAGCGACTGAGTTACTGAAGGGGTGGGAGGAAGAGGATGAGAGTATTCCTGGGAAGAGACTGTCCAGGGGAAGTGGCCAGACCTAGGGTAGGGCTGATGGCCACTATGGTTGGACACAGAGGAACAATAACAGTTGTCCACAGAGCAGACCACAATCTTACGCCCTCCATACTGGGAGAGCACAGACTGTTGAGATGATGTGCTGTTGGGGTAATGGGATGGATTGAAGACAGAATTAGAGTGGACTGGCTGGGGGCCACTGGGAAGTCCAACTATGTGCTGGGTGGAGCTGCAAGGCACCATGGGTTGTGCAGACTGGCCCTCACCAGAGGAAAAACCCTGGTTTATGTACTGGCCACTAACAGTTCCCGATGCGGAGTCAAGGAAGTTGCCCTCCTGGAAAAGCAGCTGAATGCTTGCGTTTCTCTGCACCCGAACTGCCTCCACTGCAAGAATACATTGGGATGCTCTGTAAAACCGCCCTGGGGGTGGTGAAGGAACCTACCAGCATCGTTCCGCAAATGCTTCCTCCTTCTTGTCCATTCTCGGTGCGGGAAAAACCTTGGAATTCAAGGTTGCCCAATTTTTTGGGAAGGAAGAGAGGGGAGGGCGCCGGAGGGGACAATTTTCCTAAGGTGCCGGGGCCCACCCCAAGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTGGTGACATAGTGCTTGG