ORFeome > trip13 ORF1 – XORFeome v1.0

trip13 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: trip13
Gene ID: 974903
Gene Page ID: 974897
ORF Xenbase ID: 17302497

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129530
Original XGC clone length: 1059

Human orthology & disease relationships

NCBI Entrez ID: 9319
Ensembl gene IDs: ENSG00000071539
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 151400

Library Location

Plate ID: GDExl11091
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ838735
dbEST ID: 79656437
Trimmed Sequence: ATGGATGAAGTAGCTGGAGATCTGAAGCAAGCCCTTCCAAATGTACACGACACTTTTCAAGTACATGTGGAAGTCCACCAGAAATCAAACAGCCCAGCAGCGAGTCAAGATATAAGATCTCATGTCATGCAACTATTGAATAGACATTGTGTAGTGTTTGGAGATTATTCATGGACAGAGTTTGATGACAGTTTTTTAATTAAAAATATACATTCCGTCTCCATTGTTGATACTGAATTAAAACTGAAAGACCGACAGCCCATCGATCTCAGCAAGTGCACGGTGTTGGTACATATTTTTCAGCTAAATGAAGATGGTCCTTGTACAGAAAATCTTGAAGAGGAAAATGAGGATCTTGTGGCTGCTAATCATTGGCTGCTACCTGCTGCTGATTTTCATGGTCTATGGGACAGTTTAATATACGACAGCCAAATTAAGTCCAAACTTTTAGATTATATTGAAACTGCAATGTTATTTTCTGACAAGAATGTTGACAGCAATTTGATATCCTGGAACAGAGTGGTGCTCTTGCATGGACCACCTGGAACAGGAAAAACTTCATTATGCAAGGCTCTGGCACAGAAACTCACCGTTCGACTATCAAATAGGTACAGATATGGGCAGCTTGTTGAAATCAATAGCCACAGTCTTTTTTTCAAATTGGTTTTCTGAAAATTGCAAAGTGGGTGACCAAAAAGGTTTCCAAAAAATTCCTGAACCTAATAAATGATTGAA
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGAAGTAGCTGGAGATCTGAAGCAAGCCCTTCCAAATGTACACGACACTTTTCAAGTACATGTGGAAGTCCACCAGAAATCAAACAGCCCAGCAGCGAGTCAAGATATAAGATCTCATGTCATGCAACTATTGAATAGACATTGTGTAGTGTTTGGAGATTATTCATGGACAGAGTTTGATGACAGTTTTTTAATTAAAAATATACATTCCGTCTCCATTGTTGATACTGAATTAAAACTGAAAGACCGACAGCCCATCGATCTCAGCAAGTGCACGGTGTTGGTACATATTTTTCAGCTAAATGAAGATGGTCCTTGTACAGAAAATCTTGAAGAGGAAAATGAGGATCTTGTGGCTGCTAATCATTGGCTGCTACCTGCTGCTGATTTTCATGGTCTATGGGACAGTTTAATATACGACAGCCAAATTAAGTCCAAACTTTTAGATTATATTGAAACTGCAATGTTATTTTCTGACAAGAATGTTGACAGCAATTTGATATCCTGGAACAGAGTGGTGCTCTTGCATGGACCACCTGGAACAGGAAAAACTTCATTATGCAAGGCTCTGGCACAGAAACTCACCGTTCGACTATCAAATAGGTACAGATATGGGCAGCTTGTTGAAATCAATAGCCACAGTCTTTTTTTCAAATTGGTTTTCTGAAAATTGCAAAGTGGGTGACCAAAAAGGTTTCCAAAAAATTCCTGAACCTAATAAATGATTGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGAAGTAGCTGGAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838734
dbEST ID: 79656436
Trimmed Sequence: CCTGGTTCGGCTTTTCGTGCTACTGTGTAGGTGCACCTTCATAAGTTCTTCTATGCAAGACAGATAAATTTTAAATATAGCAGCAGGAGATGGAGGTCCAATGTACTGCTTTATATCTGCTCTATCAGTAAAAGCAACATCAATTTTTTCTGTGAGGTTTGAGGTGCTTAAGATGACTACATTGGGATACCTTTTGATATGATCAATTTGTGTCAGCACAGCATTAACTACACGAATGGCATCTGAAGGCTCAGTACCAGCTCTGGAAGCTTTACGAGCTGCAGTAAGACTTTCCACCTCATCAATCAAAACAAATACTAGTGCTTCTTTATCATTTATTAGATCATGAATCTTCTGAAACATTTTAGTCACCAATTTGCCACTCTCAGAAAACCACTTTGAAAAAAGACTGTGGGGATTGATCTCGACAAGCTGCCCATATCTGTACCTATATGATAGTCTAACGGTGAGTTTCTGTGCCAGAGCCTTGCATAATGAAGTTTTTCCTGTTCCAGGTGGTCCGTGGGAGAGCAACACTCTGTTCCAGGATATGAAAGTGCTGTCGACATTCTTGTCGGAAAATAGAAATGCAGGTTTCCGTAAATCCAGAAATTTTGAAGTTAATTTGTCTGGGCGGAATGGGAAATATCCCCCTAAACCAAAAAAAAAAAAAAGGCAAGTAGGAGCCCAGGGATTAACAAACCCCAGAAAAACCTCATTATTCCTCTTTCCGGGAATTTTCGTGGTGGGGGGGGACGGGTTTTGCG
Full Trace Sequence: GAAAACGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCTGGTTCGGCTTTTCGTGCTACTGTGTAGGTGCACCTTCATAAGTTCTTCTATGCAAGACAGATAAATTTTAAATATAGCAGCAGGAGATGGAGGTCCAATGTACTGCTTTATATCTGCTCTATCAGTAAAAGCAACATCAATTTTTTCTGTGAGGTTTGAGGTGCTTAAGATGACTACATTGGGATACCTTTTGATATGATCAATTTGTGTCAGCACAGCATTAACTACACGAATGGCATCTGAAGGCTCAGTACCAGCTCTGGAAGCTTTACGAGCTGCAGTAAGACTTTCCACCTCATCAATCAAAACAAATACTAGTGCTTCTTTATCATTTATTAGATCATGAATCTTCTGAAACATTTTAGTCACCAATTTGCCACTCTCAGAAAACCACTTTGAAAAAAGACTGTGGGGATTGATCTCGACAAGCTGCCCATATCTGTACCTATATGATAGTCTAACGGTGAGTTTCTGTGCCAGAGCCTTGCATAATGAAGTTTTTCCTGTTCCAGGTGGTCCGTGGGAGAGCAACACTCTGTTCCAGGATATGAAAGTGCTGTCGACATTCTTGTCGGAAAATAGAAATGCAGGTTTCCGTAAATCCAGAAATTTTGAAGTTAATTTGTCTGGGCGGAATGGGAAATATCCCCCTAAACCAAAAAAAAAAAAAAGGCAAGTAGGAGCCCAGGGATTAACAAACCCCAGAAAAACCTCATTATTCCTCTTTCCGGGAATTTTCGTGGTGGGGGGGGACGGGTTTTGCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCTGGTTCGGCTTTTCGT