ORFeome > trmt6 ORF1 – XORFeome v1.0

trmt6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: trmt6
Gene ID: 973299
Gene Page ID: 973292
ORF Xenbase ID: 17302533

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108582
Original XGC clone length: 1449

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: JZ837997
dbEST ID: 79655699
Trimmed Sequence: ATGGAGGAGACAGACAGCGGCTCCGGCCGGCTCATAAGTGACGGAGATTGTGTGGTACTGAAGAGGCAGGAAGTGTACAAAGCTGTGCAAGTGCAGAGGAGGAAAAAAATTATATTTGAGAAGCAGTGGATATACCTGGACAATGTCATTGGCAAACATTATGGGACCACATTTGAGATCTGCAGTGGGGGAAATCTTCAAACTAAGACGGCACAAGTGACAGCTACAGAGCAGAAAGAAGCAGGGGCTGACAACCGCAATATAGTGGATGATGGGAAATCTCAGAAGCTCACTAGGGACGACATTGAAGCGTTAAAGGAAAAAGGCATTAAAGGGGAGGCAATCGTTCAGCAGCTCATTGAGAACAGCGCGACGTTTCGGGACAAGACAGAATTCGCCCAAGAGAAGTATATAAAGAAAAAAAAGAAAAAATACGAGGCAGTGATTACAATCTTAAAGCCCTCTACACGGATCCTGGCAATGATGTACTGTGCCCGGGAGCCTGCCAAAATTTGCCAGCTGCGCTATGATACCCTGGCACAGATGCTCACGCTGGGCAATATTCATGCCCGCAGTAAAGTCATCGTCATGGAGACGTGTGCCGGTCTGGTCCTGGGAGCTGTAATGAACGCCTGGGAAGAATGGGCTCAGTTTTACAGAATGTACTCAGGCGGGGGCCCCGTCCGAACAACAACTGATTCCTTTGGATTTTCAAAGTTCTTTCTCAAAGGTTTATGTTAATTCTCCATGTAACAAAAGTGGAAAAATTCCCCCTGAACGGGGACCCAACTCCCTTTGCCTTAACAACTTTCCTCCCG
Full Trace Sequence: TCGTGGGCCATATAANTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGAGACAGACAGCGGCTCCGGCCGGCTCATAAGTGACGGAGATTGTGTGGTACTGAAGAGGCAGGAAGTGTACAAAGCTGTGCAAGTGCAGAGGAGGAAAAAAATTATATTTGAGAAGCAGTGGATATACCTGGACAATGTCATTGGCAAACATTATGGGACCACATTTGAGATCTGCAGTGGGGGAAATCTTCAAACTAAGACGGCACAAGTGACAGCTACAGAGCAGAAAGAAGCAGGGGCTGACAACCGCAATATAGTGGATGATGGGAAATCTCAGAAGCTCACTAGGGACGACATTGAAGCGTTAAAGGAAAAAGGCATTAAAGGGGAGGCAATCGTTCAGCAGCTCATTGAGAACAGCGCGACGTTTCGGGACAAGACAGAATTCGCCCAAGAGAAGTATATAAAGAAAAAAAAGAAAAAATACGAGGCAGTGATTACAATCTTAAAGCCCTCTACACGGATCCTGGCAATGATGTACTGTGCCCGGGAGCCTGCCAAAATTTGCCAGCTGCGCTATGATACCCTGGCACAGATGCTCACGCTGGGCAATATTCATGCCCGCAGTAAAGTCATCGTCATGGAGACGTGTGCCGGTCTGGTCCTGGGAGCTGTAATGAACGCCTGGGAAGAATGGGCTCAGTTTTACAGAATGTACTCAGGCGGGGGCCCCGTCCGAACAACAACTGATTCCTTTGGATTTTCAAAGTTCTTTCTCAAAGGTTTATGTTAATTCTCCATGTAACAAAAGTGGAAAAATTCCCCCTGAACGGGGACCCAACTCCCTTTGCCTTAACAACTTTCCTCCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGAGACAGACAGCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837996
dbEST ID: 79655698
Trimmed Sequence: ACTCTCCTCTTCCTCAACTTTCATTTTTTTGGCTGCAGGTTCTTCACTCTTCTCTTGAGTGTTGATATTTGGCTTTGCAGGATCCATTGCTACTGTGGTTCCATGAAGTATGTACCCTCCTCCACCGCTCATCACCAGCTTGGGGTGACTTCTGCCTGGCAAAACCTGGTAATTGCGTAGCCAGGTCTCAGTCAGTTTCAGATTAACGACGCCTCCTTTTTCTCGCAGTTTTGTATAACATTCAATTAGAGGCTCTCGGTACTGACAATAAACTACAAAAGGCCTGGAAGGAGCGAGGAATTCCAACAAGGAGAGCATCAGAGGAGTGGGAAGGAATCGGGAGGCAACAATTAATCCATCAGCGTTTTTATTCTGCAACAGAGCGGCTGCTTCCGATTCTTTTCTCCTTTTCTCATCTTGTTTCCGCTTTCTTTCCAGAGCCAACTGTTTCTTTTCCTGTTTCTGGGCCTCCTCTTGGCTTAGTGGTCCCTCTCCACTGACCTCCATGGCCTCCAATTGCCCCTGTGTATTATTGTCTGTGACCGTTTTCCATTCGGGGGCCAGATTGGGATTCCTCCCCCTTTTCCTCACTCTGCTTCTGGGTTTTACTGATCTCATTGTTCCCCAGTGGCCCGGTTCTGTTCGGAAAAACTGCTAACGACGGGAATTAAGTCCCATTCAGGGAAACTCGTCCAATTAGTTACATTGGAAACCCAGATAAGCCGTTTTAAAAAAAGGAATTTGGGGGAAAATCAAAACCAAAATTCATTTTAACT
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTCTCCTCTTCCTCAACTTTCATTTTTTTGGCTGCAGGTTCTTCACTCTTCTCTTGAGTGTTGATATTTGGCTTTGCAGGATCCATTGCTACTGTGGTTCCATGAAGTATGTACCCTCCTCCACCGCTCATCACCAGCTTGGGGTGACTTCTGCCTGGCAAAACCTGGTAATTGCGTAGCCAGGTCTCAGTCAGTTTCAGATTAACGACGCCTCCTTTTTCTCGCAGTTTTGTATAACATTCAATTAGAGGCTCTCGGTACTGACAATAAACTACAAAAGGCCTGGAAGGAGCGAGGAATTCCAACAAGGAGAGCATCAGAGGAGTGGGAAGGAATCGGGAGGCAACAATTAATCCATCAGCGTTTTTATTCTGCAACAGAGCGGCTGCTTCCGATTCTTTTCTCCTTTTCTCATCTTGTTTCCGCTTTCTTTCCAGAGCCAACTGTTTCTTTTCCTGTTTCTGGGCCTCCTCTTGGCTTAGTGGTCCCTCTCCACTGACCTCCATGGCCTCCAATTGCCCCTGTGTATTATTGTCTGTGACCGTTTTCCATTCGGGGGCCAGATTGGGATTCCTCCCCCTTTTCCTCACTCTGCTTCTGGGTTTTACTGATCTCATTGTTCCCCAGTGGCCCGGTTCTGTTCGGAAAAACTGCTAACGACGGGAATTAAGTCCCATTCAGGGAAACTCGTCCAATTAGTTACATTGGAAACCCAGATAAGCCGTTTTAAAAAAAGGAATTTGGGGGAAAATCAAAACCAAAATTCATTTTAACT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTCTCCTCTTCCTCAAC