ORFeome > tsga14 ORF1 – XORFeome v1.0

tsga14 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256428
Gene Page ID:
ORF Xenbase ID: 17302599

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC127427
Original XGC clone length: 1098

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ837378
dbEST ID: 79655080
Trimmed Sequence: ATGTCAGCGAAAAGGAGCATCGGGGATCCAGAGATTTTGAAGAAAAGAATTCCACAGAATCAAAAATACCAGCATGTCAAAACAAGGCTAGATACAGGTAATAGCATGACTAAGTACATGGAAAGAATAGAAGAAATAAAGAAAAATTATAGATACAAAAAAGATGAGCTATTCAAGAGGATCAAAGTTAGCACGTTTGCTCAGCTTGTCCTTCAAGTGGCATCCGTATCAGAAGAGAGAGAAAGTGGTGAAATGACTGCTGACGAGCTTCAGAGATTAGAAGATAATAGCTCTGTGATATCAGATACTGAATTTCTGACAGACCGACCCAATGGTAAAGGCAGCCCGGTCAGTGAATCCAAAAGTCCTGTACAATTTATAGACAGTGAAAGAGGCGAAGAATTCATACAGACATCAAGGTCTACCCTTCAGAGTGTCATAAGTGGAGTAGGAGAACTGGACCTTGGAAATCAGGCTGACAAAGAAAAGCAATCTTTGCCAAGCTCCAGTGCACTAGACAAGCCCTATGAAGACTGCCCATTTCTACTCCTTGATGTAAGAGACAGAGATTCCTATGATCAGTGCCACATTGTTGGAGCCAGGAATTATCCTACTGCAATGCTTTCCAGGACAATGAACCCTTTCACATCTGAAATTCTGGAATATAGAAATGCTCATGGTAAAATTATATCCTCCTATAATGAAATAAGAAAAAAAACCAATCCAGCCTGCCCCCACAATGGTTTAAACAAGGGGTTTGAAAAAACCTGTTCCAGGTTTATCCTGGAAAGGTTATAAAAAGTCAAAAA
Full Trace Sequence: TCGGGGGCCCAATAATTGATTTTATTTCTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGCGAAAAGGAGCATCGGGGATCCAGAGATTTTGAAGAAAAGAATTCCACAGAATCAAAAATACCAGCATGTCAAAACAAGGCTAGATACAGGTAATAGCATGACTAAGTACATGGAAAGAATAGAAGAAATAAAGAAAAATTATAGATACAAAAAAGATGAGCTATTCAAGAGGATCAAAGTTAGCACGTTTGCTCAGCTTGTCCTTCAAGTGGCATCCGTATCAGAAGAGAGAGAAAGTGGTGAAATGACTGCTGACGAGCTTCAGAGATTAGAAGATAATAGCTCTGTGATATCAGATACTGAATTTCTGACAGACCGACCCAATGGTAAAGGCAGCCCGGTCAGTGAATCCAAAAGTCCTGTACAATTTATAGACAGTGAAAGAGGCGAAGAATTCATACAGACATCAAGGTCTACCCTTCAGAGTGTCATAAGTGGAGTAGGAGAACTGGACCTTGGAAATCAGGCTGACAAAGAAAAGCAATCTTTGCCAAGCTCCAGTGCACTAGACAAGCCCTATGAAGACTGCCCATTTCTACTCCTTGATGTAAGAGACAGAGATTCCTATGATCAGTGCCACATTGTTGGAGCCAGGAATTATCCTACTGCAATGCTTTCCAGGACAATGAACCCTTTCACATCTGAAATTCTGGAATATAGAAATGCTCATGGTAAAATTATATCCTCCTATAATGAAATAAGAAAAAAAACCAATCCAGCCTGCCCCCACAATGGTTTAAACAAGGGGTTTGAAAAAACCTGTTCCAGGTTTATCCTGGAAAGGTTATAAAAAGTCAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGCGAAAAGGAGCATCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837377
dbEST ID: 79655079
Trimmed Sequence: TTTCCAAGGCTTGGAGTGTGAGCTGGTGCTACTTAGTGACCGGGCTGAGCTGGCAGACGATGGGACTTTGCTGTTTCTTGAATCCAACCTGAGGCGGCTGGGTGTGCTTGTTGACATGAGCATATTTTCTACATGGTTTTCTATAATTTCCAGATCCTGAGATGAAAATCTCCACTTGTTCTCAGCAGGTACAATGGGATCCCTTGGTGTTCGTTTAAGAGCAGACTTTGTCTGGGTAGGCGGAGCCAGACAGGTGCTTGGAAAAGAGCCAGTTGTAAGACCTTGAGGGAAGTTTTGTGATATGACTTTTAAACCTCCAGATAACATGAACAGATTCTCAAACCCTCGCTCACACATAGTGGTGGCAGCCTGACTGGCTATTCTCTCATCTTCATCATAGAGGATAATAATTTTACCATGAGCATTTCTATATTCCAGAATTTCATATGTGAGAGGGTTGGTTGTCCTGGAAAGCATTGCAGTAGGATAGTTCCTCGCTCCGACAATAATACACTGATCATAAAAATCTATCTCTCTTCCATCAAGCAGGAGAATGAAAAGGCGTCCTATGGGTTGGCGGGTGGACGGGGGCCTGGGCAAAAATGCTTTTCCTTTTTCTCCCGGACTTGCGAGGGCCAAGTGTCCTACCCCCCCTACAAACCCTCTAGACAGGTGGGGGGTGGGGTTTGGGGGTG
Full Trace Sequence: GGAAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCCAAGGCTTGGAGTGTGAGCTGGTGCTACTTAGTGACCGGGCTGAGCTGGCAGACGATGGGACTTTGCTGTTTCTTGAATCCAACCTGAGGCGGCTGGGTGTGCTTGTTGACATGAGCATATTTTCTACATGGTTTTCTATAATTTCCAGATCCTGAGATGAAAATCTCCACTTGTTCTCAGCAGGTACAATGGGATCCCTTGGTGTTCGTTTAAGAGCAGACTTTGTCTGGGTAGGCGGAGCCAGACAGGTGCTTGGAAAAGAGCCAGTTGTAAGACCTTGAGGGAAGTTTTGTGATATGACTTTTAAACCTCCAGATAACATGAACAGATTCTCAAACCCTCGCTCACACATAGTGGTGGCAGCCTGACTGGCTATTCTCTCATCTTCATCATAGAGGATAATAATTTTACCATGAGCATTTCTATATTCCAGAATTTCATATGTGAGAGGGTTGGTTGTCCTGGAAAGCATTGCAGTAGGATAGTTCCTCGCTCCGACAATAATACACTGATCATAAAAATCTATCTCTCTTCCATCAAGCAGGAGAATGAAAAGGCGTCCTATGGGTTGGCGGGTGGACGGGGGCCTGGGCAAAAATGCTTTTCCTTTTTCTCCCGGACTTGCGAGGGCCAAGTGTCCTACCCCCCCTACAAACCCTCTAGACAGGTGGGGGGTGGGGTTTGGGGGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCCAAGGCTTGGAGTGT