ORFeome > tsku ORF1 – XORFeome v1.0

tsku ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tsku
Gene ID: 866233
Gene Page ID: 493205
ORF Xenbase ID: 17302605

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108803
Original XGC clone length: 1056

Human orthology & disease relationships

NCBI Entrez ID: 25987
Ensembl gene IDs: ENSG00000182704
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 112600,158350,261550,609441,610069

Library Location

Plate ID: GDExl11085
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ837703
dbEST ID: 79655405
Trimmed Sequence: ATGGCTCTTTCTTCTTGGATTTTCTTTCTTCTCGTCCACGGAATCGTCGGAGGGAGCAGGACCTGCTTCCCGGGGTGTCGGTGCATCGTGGATAACTTTGGCCTGTTCCACAGCTTCAGCTTGACCAAAGTCGATTGCAGCCGCGTCGGACCCCATGTGGTCCCGGTCTCCATTCCGCTGGATACCTCGTATCTGGATCTCTCCTCTAACAGGCTGAAAAGGATCAATGAGACTGTGCTGTCCGGACCTGGATATACAACTTTGATGAACCTTAACTTGAGCTACAACCAGATCGTCAAGATCTCCTACTCCACCTTCTCCAAACTGAGATACCTGGAATCTTTGGACTTGAGTCACAACCTTCTGGAAACCTTACCGGACGGCAGTTTTTTATATTCACGCCTCACAGAACTCGACTTGAGTTCTAACAAGATCCAGAAGGTCGGTGTTGGTGCCTTCACTCTGAAAAGCCAGGGAAGGTCCATGGCCATCAATCTTGCAAACAACGAGATCCATTCCATCTTTCCAGGAGCGGAGCGTCCTGTTTCCAAACTCCATAGCCTAATGTTGTATGGAAACAAGCTTCTCTCTGTGCCGGATCTCCATGGAATCCGGCTCCGCCCCCTTTATTTGAACAGGAACCCTCCTTTCCAAGAATGAAAAGGGGAACTTTTCTTGGGCTGGAGAGTCTCAACCCCTTTATCCCTTATCGACCTGCCCAATTTTAAAAAAGAGTCTCTCCTTTAGGATTTT
Full Trace Sequence: CCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCTTTCTTCTTGGATTTTCTTTCTTCTCGTCCACGGAATCGTCGGAGGGAGCAGGACCTGCTTCCCGGGGTGTCGGTGCATCGTGGATAACTTTGGCCTGTTCCACAGCTTCAGCTTGACCAAAGTCGATTGCAGCCGCGTCGGACCCCATGTGGTCCCGGTCTCCATTCCGCTGGATACCTCGTATCTGGATCTCTCCTCTAACAGGCTGAAAAGGATCAATGAGACTGTGCTGTCCGGACCTGGATATACAACTTTGATGAACCTTAACTTGAGCTACAACCAGATCGTCAAGATCTCCTACTCCACCTTCTCCAAACTGAGATACCTGGAATCTTTGGACTTGAGTCACAACCTTCTGGAAACCTTACCGGACGGCAGTTTTTTATATTCACGCCTCACAGAACTCGACTTGAGTTCTAACAAGATCCAGAAGGTCGGTGTTGGTGCCTTCACTCTGAAAAGCCAGGGAAGGTCCATGGCCATCAATCTTGCAAACAACGAGATCCATTCCATCTTTCCAGGAGCGGAGCGTCCTGTTTCCAAACTCCATAGCCTAATGTTGTATGGAAACAAGCTTCTCTCTGTGCCGGATCTCCATGGAATCCGGCTCCGCCCCCTTTATTTGAACAGGAACCCTCCTTTCCAAGAATGAAAAGGGGAACTTTTCTTGGGCTGGAGAGTCTCAACCCCTTTATCCCTTATCGACCTGCCCAATTTTAAAAAAGAGTCTCTCCTTTAGGATTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCTTTCTTCTTGGATTTTC

Sequences - 3ʹ (reverse) EST

Accession: JZ837702
dbEST ID: 79655404
Trimmed Sequence: CAAAATGTCTTGTGCCGGAACAGCACCATTGTCATCGTGGCAAAGTAAGACTTCTTTTCGGACTCGACCTTTCTGTGCATGGAAGATGCTTTCCTTCACAGTCTTCAAGCAACGGATATTTTCCCCCCAAGTAATGCTCTTCATGGAGGGCAGGTGGAGCATGATATCCTTGGGCAAGAAGGCCACAACAGAATAGGCCAAGTTGAGCTCCTGCAAGGCTTTCAAGCCAAAGAACATGTCAGAACTTAGAGACTTTAGGTTGGGGTTGTTGGACAAGTCAAGTTCCAATAGAGACGTCAAACTTTTGAAACTGTAAAGAGAGACCTCTCTTAAATTTGGCAGGTCGCTAAGGGATAAGTGTGTGAGACTTTCAAGCCCGAGAAAGCTCACCTTCTCGATCGTGGGGGGAGGGTTCGTGTCGGAATTAGGGTGGGGGAGGGGGAGGGGCGGAGAACCGGGCGAGAGAGGAACTGGGGTGGCACAAAGAGAGAGGCGAGCGAGGGGGGGAAGAGAACGGGCCGCGGCGGGCGGAGGAGGAGGGGGGGGGGCCTGGGGGGGAGGAGAGGAGGGGGAGGGAGCGGGGCTTGCGTGGGGCGGAGGAAAGGGCGGGGGCGGACGCGGAGGGGGGGGGGTGGGGGGGAGGGGGAGGAGATGTAGGGGGGGGGAGAAAAAGAGGGGGGGGCGTGGGGGGGGGGGGGGGGGGAGGAGGGGGGGGAGAGGAGGGGGAGCGGGGCGGGGGGGGGAATGAGGGGGGGAGAGGGGAGGGGGGGAGATGGGGGGAGTGGGAGGGGGGGGGGGGAGGGGGGGGGGGGGCGGGGAGGGGGGGGGAGGAGGGGGGAGGGCGGGAGCGGGCGAGAGGGGGGCGGGAGGGGGGGAGGGAGGGGGAGGGGAGGAGGCGAGAGGGGAGGGGAGGGGGGGGGGGAGGGGAGGAGGGGAGAGGGAGGGGGGAGGAGGGGGGGAGAGGGGGAGGGGGGGGGGGGGAAGGGGTGGGGGGGGGGAGAGAGGAGGGGGGGGGAGAGAGGGAGGGGGGGGGGAAGGAGGAAGGGGGGGGGGAGGGACGGGGAGGGGGTGGGAGGGGAGAGAGAAGGGTAATGAAGAAAAGAAAACAAAACGAAGAGGAGGGAGGCAGAACGGTGGGGGGGGGGGGGGGGGGCGTGAGGGGGGGGAGAGGGGGGAGGGAAAAGAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAGAAAAGACGAAACAAAAGAAAAATACATCCTCATCACCACACCAAGAGAAAA
Full Trace Sequence: GGGCAGGGAAACAGCCACTGAACAAGGACAAACGAAGTCACTAAGACGGGGAAGAAAGCCAGGAGGGCAAAAACGGAGATATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAAATGTCTTGTGCCGGAACAGCACCATTGTCATCGTGGCAAAGTAAGACTTCTTTTCGGACTCGACCTTTCTGTGCATGGAAGATGCTTTCCTTCACAGTCTTCAAGCAACGGATATTTTCCCCCCAAGTAATGCTCTTCATGGAGGGCAGGTGGAGCATGATATCCTTGGGCAAGAAGGCCACAACAGAATAGGCCAAGTTGAGCTCCTGCAAGGCTTTCAAGCCAAAGAACATGTCAGAACTTAGAGACTTTAGGTTGGGGTTGTTGGACAAGTCAAGTTCCAATAGAGACGTCAAACTTTTGAAACTGTAAAGAGAGACCTCTCTTAAATTTGGCAGGTCGCTAAGGGATAAGTGTGTGAGACTTTCAAGCCCGAGAAAGCTCACCTTCTCGATCGTGGGGGGAGGGTTCGTGTCGGAATTAGGGTGGGGGAGGGGGAGGGGCGGAGAACCGGGCGAGAGAGGAACTGGGGTGGCACAAAGAGAGAGGCGAGCGAGGGGGGGAAGAGAACGGGCCGCGGCGGGCGGAGGAGGAGGGGGGGGGGCCTGGGGGGGAGGAGAGGAGGGGGAGGGAGCGGGGCTTGCGTGGGGCGGAGGAAAGGGCGGGGGCGGACGCGGAGGGGGGGGGGTGGGGGGGAGGGGGAGGAGATGTAGGGGGGGGGAGAAAAAGAGGGGGGGGCGTGGGGGGGGGGGGGGGGGGAGGAGGGGGGGGAGAGGAGGGGGAGCGGGGCGGGGGGGGGAATGAGGGGGGGAGAGGGGAGGGGGGGAGATGGGGGGAGTGGGAGGGGGGGGGGGGAGGGGGGGGGGGGGCGGGGAGGGGGGGGGAGGAGGGGGGAGGGCGGGAGCGGGCGAGAGGGGGGCGGGAGGGGGGGAGGGAGGGGGAGGGGAGGAGGCGAGAGGGGAGGGGAGGGGGGGGGGGAGGGGAGGAGGGGAGAGGGAGGGGGGAGGAGGGGGGGAGAGGGGGAGGGGGGGGGGGGGAAGGGGTGGGGGGGGGGAGAGAGGAGGGGGGGGGAGAGAGGGAGGGGGGGGGGAAGGAGGAAGGGGGGGGGGAGGGACGGGGAGGGGGTGGGAGGGGAGAGAGAAGGGTAATGAAGAAAAGAAAACAAAACGAAGAGGAGGGAGGCAGAACGGTGGGGGGGGGGGGGGGGGGCGTGAGGGGGGGGAGAGGGGGGAGGGAAAAGAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAGAAAAGACGAAACAAAAGAAAAATACATCCTCATCACCACACCAAGAGAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAAATGTCTTGTGCCGGAA