ORFeome > tsku ORF2 – XORFeome v1.0

tsku ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tsku
Gene ID: 6251980
Gene Page ID: 493205
ORF Xenbase ID: 17302611

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106425
Original XGC clone length: 1056

Human orthology & disease relationships

NCBI Entrez ID: 25987
Ensembl gene IDs: ENSG00000182704
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 112600,158350,261550,609441,610069

Library Location

Plate ID: GDExl11086
Well Location: E11

Sequences - 5สน (forward) EST

Accession: JZ837963
dbEST ID: 79655665
Trimmed Sequence: ATGGCTCTTTCTTCTTGGATTTTCTTTCTTCTCGTCCATGGAATCGTCGGAGCGAGCAGGACCTGCTTCCCGGGGTGTCGGTGCATCGTGGATAACTTTGGCCTGTTCCACAGCTTCAGCTTGACCAAAGTCGATTGCAGCGACGTCGGACCCCATGTGGTCCCGGTCTCCATTCCGCTGGATACCTCGTATCTGGATCTCTCCTCCAACAGGCTAAAAACCATCAATGAATCCGTGCTGTCCGGACCTGGATATACAACTTTGATAAACCTTAACTTGAGCTACAACCAGATCGTCAAGATCTCCTACTCCACCTTCTCCAAACTGAGATACCTGGAATCTTTGGACCTTAGTCACAACCTTCTGGAAACCTTACCCGATGGCAGCTTTTTATATTCACGCCTCACAGAACTTGACTTGAGTTCCAACAAGCTCCAGAAGGTCGGTGTTGGTGCCTTCACTCTGAAAAGTCAAGGAAGATCCATGACCATCAATCTTGCAAACAACGAGATCCATTCCATCTCCATAGGAGCTGAGCGTCCTGTTCCGAACATCCACAGCCTAATGTTGTCTGGAAACCGGCTTCTCTCTGTGCCGGATCTCCATGGAATCGCCCTCCTTCAACTTGATTTGGACAGGAACCCTCTTTCCAGATTGACAAAGAGAAGCTTTCGGGGCTTGAAGGGCTCAGGACTTATCACTGAACCACCTTCCAAACTTAAAAGAGGTTTCCCCCTTAAGTTTTCCAAAGTTTTACAATCTCTTTGGGAAATTTACTTTGTCCACAAACCCCCAATTCAAAAACCCCTTAAATTTTTTAAA
Full Trace Sequence: CGTGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCTTTCTTCTTGGATTTTCTTTCTTCTCGTCCATGGAATCGTCGGAGCGAGCAGGACCTGCTTCCCGGGGTGTCGGTGCATCGTGGATAACTTTGGCCTGTTCCACAGCTTCAGCTTGACCAAAGTCGATTGCAGCGACGTCGGACCCCATGTGGTCCCGGTCTCCATTCCGCTGGATACCTCGTATCTGGATCTCTCCTCCAACAGGCTAAAAACCATCAATGAATCCGTGCTGTCCGGACCTGGATATACAACTTTGATAAACCTTAACTTGAGCTACAACCAGATCGTCAAGATCTCCTACTCCACCTTCTCCAAACTGAGATACCTGGAATCTTTGGACCTTAGTCACAACCTTCTGGAAACCTTACCCGATGGCAGCTTTTTATATTCACGCCTCACAGAACTTGACTTGAGTTCCAACAAGCTCCAGAAGGTCGGTGTTGGTGCCTTCACTCTGAAAAGTCAAGGAAGATCCATGACCATCAATCTTGCAAACAACGAGATCCATTCCATCTCCATAGGAGCTGAGCGTCCTGTTCCGAACATCCACAGCCTAATGTTGTCTGGAAACCGGCTTCTCTCTGTGCCGGATCTCCATGGAATCGCCCTCCTTCAACTTGATTTGGACAGGAACCCTCTTTCCAGATTGACAAAGAGAAGCTTTCGGGGCTTGAAGGGCTCAGGACTTATCACTGAACCACCTTCCAAACTTAAAAGAGGTTTCCCCCTTAAGTTTTCCAAAGTTTTACAATCTCTTTGGGAAATTTACTTTGTCCACAAACCCCCAATTCAAAAACCCCTTAAATTTTTTAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCTTTCTTCTTGGATTTTC

Sequences - 3สน (reverse) EST

Accession: JZ837962
dbEST ID: 79655664
Trimmed Sequence: CAAAAGGTCTTGTGCCGGCACAGCACCATGGTCATCGTGGCAAAGTAAGACTTCTTTTTGGACTTTGCCTTTCTGTGCATGGAATATGCTTTCCTTCACAGTCTTCAAGCAACGGATATTTTCCCCCCAAGTAATGCTCTTCATGGAGGGCAGGTGGAGCATGATATCTTTTGGCAAGTAGGCCACACCAGAATAAGCCAAGTCGAGCTCCTGCAAGGCGTTCAAGCCAAAGAACATGTCAGAACTTAGAGACTTTAGATTGGGGTTGTTGGACAAGTCAAGTTCCAAGAGAGACGTCAAACTTTTGAAACTGTAAGGCGAGACCTCTCTTAAGTTTGGCAAGTCGCTCAGTGATAAGTGTGTGAGACCTTCAAGCCCCACAAAGCTCTCCTTCTCAATCTTGGAAAGAGGGTTCCTGTCCAAATCAAGTTGATGGAGTGGGATTCCATGGAGATCCGGCACAGAGAGAAGCCGGTTTCCATACAACATTAAGCTGTGGATGTTCGGAACAGGACGCTCAGCTCCTCTGGAGATGGAATGGATCTCGTTGTTTTGGAGATTGATGGTCATGGATCTTCCTTGACTTTTTCGGATTGAAGGCACCAGCACCGACCCTTCTACGACCTTGTTGGAACTCAGGTGGAAGTTCTGTAACGCCTGAAAATAAGAAACTGCCATCCGTTAAGGGTTTCAAAGAAGGTGCGGACTAAGGGTCAAAAAATACCAAAGATCTCCAAAGTTTGGAAAAAGGGGTTGGAATTAAGGAGAAAACATTAAG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAAAGGTCTTGTGCCGGCACAGCACCATGGTCATCGTGGCAAAGTAAGACTTCTTTTTGGACTTTGCCTTTCTGTGCATGGAATATGCTTTCCTTCACAGTCTTCAAGCAACGGATATTTTCCCCCCAAGTAATGCTCTTCATGGAGGGCAGGTGGAGCATGATATCTTTTGGCAAGTAGGCCACACCAGAATAAGCCAAGTCGAGCTCCTGCAAGGCGTTCAAGCCAAAGAACATGTCAGAACTTAGAGACTTTAGATTGGGGTTGTTGGACAAGTCAAGTTCCAAGAGAGACGTCAAACTTTTGAAACTGTAAGGCGAGACCTCTCTTAAGTTTGGCAAGTCGCTCAGTGATAAGTGTGTGAGACCTTCAAGCCCCACAAAGCTCTCCTTCTCAATCTTGGAAAGAGGGTTCCTGTCCAAATCAAGTTGATGGAGTGGGATTCCATGGAGATCCGGCACAGAGAGAAGCCGGTTTCCATACAACATTAAGCTGTGGATGTTCGGAACAGGACGCTCAGCTCCTCTGGAGATGGAATGGATCTCGTTGTTTTGGAGATTGATGGTCATGGATCTTCCTTGACTTTTTCGGATTGAAGGCACCAGCACCGACCCTTCTACGACCTTGTTGGAACTCAGGTGGAAGTTCTGTAACGCCTGAAAATAAGAAACTGCCATCCGTTAAGGGTTTCAAAGAAGGTGCGGACTAAGGGTCAAAAAATACCAAAGATCTCCAAAGTTTGGAAAAAGGGGTTGGAATTAAGGAGAAAACATTAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAAAGGTCTTGTGCCGG