ORFeome > tspan8 ORF1 – XORFeome v1.0

tspan8 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tspan8
Gene ID: 1016297
Gene Page ID: 1016290
ORF Xenbase ID: 17302719

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054295
Original XGC clone length: 684

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: C06

Sequences - 5ʹ (forward) EST

Accession: JZ839487
dbEST ID: 79657189
Trimmed Sequence: ATGGCTGGGGTTAGCAAGTGCATCAAATATTCCATGTTCGCATTCAACTTTTTATTTTGGCTTTGTGGCTGTGTAATTTTGGGTGTCTCAATTTGGGTCCGAGTCAGCAAAAATGTGCAAAAAGAACTGAACATTGAAGGAGGAAGCTTGCTTGCAGCAGTTGATCTCATGATTGCAGTGGGTGCAATTATCATGGTCCTTGGATTCTTTGGATGCTGCGGGGCCATTAGAGAAAGTCGGTGCTTGCTGCTTCTGTTCTTTATTGGATTATTTCTTATTCTTGCTCTTCAAATCACTGCTGGAATTTTAGGAGTTGTTTATAAACCAAAGATTGATGCACAGTTAACTGAAAGTTTCCAGAAACTTCTCCCATTATCTGGTCAAGATGAGAGTTTTAAGAACAGCTTTGAAACTATCCAGAAAGAGAATGAATGCTGTGGTCTAGTACATGGCTATACTGACTGGGGTGCCAATGTTCCCGCCTCTTGCAACTGTCCCTCAACTGGTAATTGCGTCAGTTCTGGTGGGAACAAATACTATCAAGAGACATGTTTAAACATAATCGCTGACTTCTTCAAGAAGCACCTTGCAATAATCATTGTAATAGCTTTTGGACTGGCAGCGGTGGAGCTTTTTGGTCTTGGTTTCTCGATAAAATTGAACTTGCCAATAGGGAGAAAATTGCCAACTTTCTTGGTACAAAGTTGGAATTAAAGAAAAGAATGCCTAAACAGGTTTTTGGCAACAAAAGGGTCCCTAACAACCAAAAATAAATTTATTAGTTTGCCCTTCCAAGCTAATATCCCCCAAAAAAAAAAAAAAAAAAAAAAC
Full Trace Sequence: TCGAGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGGGGTTAGCAAGTGCATCAAATATTCCATGTTCGCATTCAACTTTTTATTTTGGCTTTGTGGCTGTGTAATTTTGGGTGTCTCAATTTGGGTCCGAGTCAGCAAAAATGTGCAAAAAGAACTGAACATTGAAGGAGGAAGCTTGCTTGCAGCAGTTGATCTCATGATTGCAGTGGGTGCAATTATCATGGTCCTTGGATTCTTTGGATGCTGCGGGGCCATTAGAGAAAGTCGGTGCTTGCTGCTTCTGTTCTTTATTGGATTATTTCTTATTCTTGCTCTTCAAATCACTGCTGGAATTTTAGGAGTTGTTTATAAACCAAAGATTGATGCACAGTTAACTGAAAGTTTCCAGAAACTTCTCCCATTATCTGGTCAAGATGAGAGTTTTAAGAACAGCTTTGAAACTATCCAGAAAGAGAATGAATGCTGTGGTCTAGTACATGGCTATACTGACTGGGGTGCCAATGTTCCCGCCTCTTGCAACTGTCCCTCAACTGGTAATTGCGTCAGTTCTGGTGGGAACAAATACTATCAAGAGACATGTTTAAACATAATCGCTGACTTCTTCAAGAAGCACCTTGCAATAATCATTGTAATAGCTTTTGGACTGGCAGCGGTGGAGCTTTTTGGTCTTGGTTTCTCGATAAAATTGAACTTGCCAATAGGGAGAAAATTGCCAACTTTCTTGGTACAAAGTTGGAATTAAAGAAAAGAATGCCTAAACAGGTTTTTGGCAACAAAAGGGTCCCTAACAACCAAAAATAAATTTATTAGTTTGCCCTTCCAAGCTAATATCCCCCAAAAAAAAAAAAAAAAAAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGGGTTAGCAAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839486
dbEST ID: 79657188
Trimmed Sequence: TTTCTTCCCTATTTGGCAGTACAATGTCATCGAGAAACCAAGACCAAAAAGCTCCACCGCTGCCAGTCCAAAAGCTATTCCAATGATTATTGCAAGGTGCTTCTTGAAGAAGTCAGCGATTATGTTTAAACATGTCTCTTTATAGTATTTGTTCCCACCAGAACTGACGCAATTACCAGTTGAGGGACAGTTGCAAGAGGCGGGAACATTGGCACCCCAGTCAGTATAGCCATGTACTAGACCACAGCATTCATTCTCTTTCTGGATAGTTTCAAAGCTGTTCTTAAAACTCTCATCTTGACCAGATAATGGGAGAAGTTTCTGGAAACTTTCAGTTAACTGTGCATCAATCTTTGGTTTATAAACAACTCCTAAAATTCCAGCAGTGATTTGAAGAGCAAGAATAAGAAATAATCCAATAAAGAACAGAAGCAGCAAGCACCGACTTTCTCTAATGGCCCCGCAGCATCCAAAGAATCCGAGGACCATGATAATTGCACCCACTGCAATCATGAGATCAACTGCTGCAAGCAAGCTTCCTCCTTCAATGGTCAGTTCTTTATGCACATTTTTGCTGACTCCGGACCCAAATTCAGACACCCGAAATTAAACAGCCAAAAGGCCCAAAATAAAAAATTGAAGGCCAAACAGGGAAAAATTGAGGCACTTTGCTACCGCGGCCAAGGGTTGCAAACGTTGTTGGTAAAAAATTGGGCAATAATAAAAAGACAATTCTCCCACCAGTTTTTTTGCCAAGAAAAAAGAGGGTGAAGAAGAAAAA
Full Trace Sequence: GAAAAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTCCCTATTTGGCAGTACAATGTCATCGAGAAACCAAGACCAAAAAGCTCCACCGCTGCCAGTCCAAAAGCTATTCCAATGATTATTGCAAGGTGCTTCTTGAAGAAGTCAGCGATTATGTTTAAACATGTCTCTTTATAGTATTTGTTCCCACCAGAACTGACGCAATTACCAGTTGAGGGACAGTTGCAAGAGGCGGGAACATTGGCACCCCAGTCAGTATAGCCATGTACTAGACCACAGCATTCATTCTCTTTCTGGATAGTTTCAAAGCTGTTCTTAAAACTCTCATCTTGACCAGATAATGGGAGAAGTTTCTGGAAACTTTCAGTTAACTGTGCATCAATCTTTGGTTTATAAACAACTCCTAAAATTCCAGCAGTGATTTGAAGAGCAAGAATAAGAAATAATCCAATAAAGAACAGAAGCAGCAAGCACCGACTTTCTCTAATGGCCCCGCAGCATCCAAAGAATCCGAGGACCATGATAATTGCACCCACTGCAATCATGAGATCAACTGCTGCAAGCAAGCTTCCTCCTTCAATGGTCAGTTCTTTATGCACATTTTTGCTGACTCCGGACCCAAATTCAGACACCCGAAATTAAACAGCCAAAAGGCCCAAAATAAAAAATTGAAGGCCAAACAGGGAAAAATTGAGGCACTTTGCTACCGCGGCCAAGGGTTGCAAACGTTGTTGGTAAAAAATTGGGCAATAATAAAAAGACAATTCTCCCACCAGTTTTTTTGCCAAGAAAAAAGAGGGTGAAGAAGAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTCCCTATTTGGCAGTACA