ORFeome > tsta3 ORF1 – XORFeome v1.0

tsta3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tsta3
Gene ID: 5754292
Gene Page ID: 5754212
ORF Xenbase ID: 17302749

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123104
Original XGC clone length: 954

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ838198
dbEST ID: 79655900
Trimmed Sequence: ATGGAGGGAAAGCGCATCCTGGTAACTGGGGGCTCAGGCCTGGTGGGCAAAGCCATAGAGAAGGTGGTGGCAGATGGAGAGGGGCGACCAGACGAGCAGTGGATTTTCATTAGCTCCAAAGATGCCGACTTGACGAATGCGGCCGACACCAAATGTCTGTTTGAGAAGCACAAACCCACTCATGTTATTCACTTGGCGGCTATGGTGGGGGGGCTGTTCCGGAACATGAAGTACAACCTGGATTTCCTGAAAAACAACCTGCACATCAATGACCATGTCCTGCATTCTGCCTACAAAATGGGGGTCCAGAAGGTGGTGTCGTGCCTTTCTACCTGCATCTTCCCAGACAAGACCACCTATCCTATCGATGAGACCATGATCCACAACGGGCCCCCCCACACCTCTTACTTTGTCTATTCCTATGCAAAGAGAATGATGGATGTGCGGAACGGAACTTACTATGAACAGCACGGCTGTAATTTCACCTGCGGCATTCACACCCGCGTCGTCGGCCCAGAGGAAAAATTTCATATTGACGATTAAACATGTGCTGGGGGGGGTCGGGCCACAACTCTACTCTACAAAACAAAAAAACAAAGCTCTCTGGGGTGGGGGGCCCGGGGGGAGCGGC
Full Trace Sequence: TCGGGGGCCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGGAAAGCGCATCCTGGTAACTGGGGGCTCAGGCCTGGTGGGCAAAGCCATAGAGAAGGTGGTGGCAGATGGAGAGGGGCGACCAGACGAGCAGTGGATTTTCATTAGCTCCAAAGATGCCGACTTGACGAATGCGGCCGACACCAAATGTCTGTTTGAGAAGCACAAACCCACTCATGTTATTCACTTGGCGGCTATGGTGGGGGGGCTGTTCCGGAACATGAAGTACAACCTGGATTTCCTGAAAAACAACCTGCACATCAATGACCATGTCCTGCATTCTGCCTACAAAATGGGGGTCCAGAAGGTGGTGTCGTGCCTTTCTACCTGCATCTTCCCAGACAAGACCACCTATCCTATCGATGAGACCATGATCCACAACGGGCCCCCCCACACCTCTTACTTTGTCTATTCCTATGCAAAGAGAATGATGGATGTGCGGAACGGAACTTACTATGAACAGCACGGCTGTAATTTCACCTGCGGCATTCACACCCGCGTCGTCGGCCCAGAGGAAAAATTTCATATTGACGATTAAACATGTGCTGGGGGGGGTCGGGCCACAACTCTACTCTACAAAACAAAAAAACAAAGCTCTCTGGGGTGGGGGGCCCGGGGGGAGCGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGGAAAGCGCATCCTGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838197
dbEST ID: 79655899
Trimmed Sequence: CTTTCTGGCCTGGGCATAGTTACTGTTAAACCAGTTACAGGTTTCCTGCACCGCTTTATTGAAGGGGGTGAACTGAAAGTCCGGCAGGTATTTCCTGAGCTTGTGGTTACTCGCAGTCTTCTTGAACTGCCCATCAGACTTTGTGCTGTCGAAAATCAGCTCTCCCTTAAACTCCATGGCTGCTACGATGCTCTCGGCTGCTTCCTTGATGGACACCTCATCCTCCTCTCCAACAGAAAGAATAATGGGGTCAACCTCATTGTACTCCCTCAGCACCCAAATGAAAAGCCTTGCAAGATCCAGTGAATAGATGAACTGTCTCCGTGGTTGCCCCGTGCCCCAGATAGAGAGAGCAGTGCCATTCTGCTTGGCCGAGTAGACTTTGTGGATGAGCCCCGGCAGGACATGCCCATCGTCAATATTGAAATTATCGTGTGGGCCGAAGACGTTGGTGGGAATGACGGAGGTGAACTTACAGCCGTGCTGTTCATAGTAAGCTCTGTTCTGCACATCGATCATTCTCTTTGCATAGGAATAGCCAAAGTTAGAGGTGTGGGGGGGGCGCGTTGTGGATCATGGTCTCATCGATAGGAAAAGGTGGTCTTGTCTGGGAAAGATTCAGGTAAAAAAGCACGACCACAACCTTCGGGACCCCCATTTTCCTAGCCAAAAGGCAGGAACTTTTTTCATTGAAGGTTCCAGGTTTGTTTCCCAAGGAAAATTCCCGGGTTTTAACCTTT
Full Trace Sequence: GGGCAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTCTGGCCTGGGCATAGTTACTGTTAAACCAGTTACAGGTTTCCTGCACCGCTTTATTGAAGGGGGTGAACTGAAAGTCCGGCAGGTATTTCCTGAGCTTGTGGTTACTCGCAGTCTTCTTGAACTGCCCATCAGACTTTGTGCTGTCGAAAATCAGCTCTCCCTTAAACTCCATGGCTGCTACGATGCTCTCGGCTGCTTCCTTGATGGACACCTCATCCTCCTCTCCAACAGAAAGAATAATGGGGTCAACCTCATTGTACTCCCTCAGCACCCAAATGAAAAGCCTTGCAAGATCCAGTGAATAGATGAACTGTCTCCGTGGTTGCCCCGTGCCCCAGATAGAGAGAGCAGTGCCATTCTGCTTGGCCGAGTAGACTTTGTGGATGAGCCCCGGCAGGACATGCCCATCGTCAATATTGAAATTATCGTGTGGGCCGAAGACGTTGGTGGGAATGACGGAGGTGAACTTACAGCCGTGCTGTTCATAGTAAGCTCTGTTCTGCACATCGATCATTCTCTTTGCATAGGAATAGCCAAAGTTAGAGGTGTGGGGGGGGCGCGTTGTGGATCATGGTCTCATCGATAGGAAAAGGTGGTCTTGTCTGGGAAAGATTCAGGTAAAAAAGCACGACCACAACCTTCGGGACCCCCATTTTCCTAGCCAAAAGGCAGGAACTTTTTTCATTGAAGGTTCCAGGTTTGTTTCCCAAGGAAAATTCCCGGGTTTTAACCTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTCTGGCCTGGGCATAGT