ORFeome > ttc25 ORF1 – XORFeome v1.0

ttc25 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ttc25
Gene ID: 5960311
Gene Page ID: 5960303
ORF Xenbase ID: 17302761

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108468
Original XGC clone length: 1596

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11063
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: JZ833730
dbEST ID: 79651432
Trimmed Sequence: ATGGCTGAGGAGACGGACGAGCAACAGGCGCCCCAAAGCACATTCAGCACTTACATGGCAGAGGGGGAGCAGCTGTATCACAAGGCGGAGTACAAGAAGGCCTCAGACAGTTTCACTGCGGCACTTCAGCTCCAACCTGAAGAGAAGAACTGCCTCGTTGCTCGTTCCAAGTGTTTCCTAAAACTCGGGGAGCCAGAATGTGCCCTGAAGGATGCAGAGGCCTCTCTACAGATCGAAAACGATTTCTTCAAGGGTCTTTACCAGAAGGCAGAGGCGCTCTACGCCATGGGAGACTTTGAGTTTGCCCTTGTGCATTACCACAGAGGGTACAAGCTGCGACCAGAATTTCAGGGATTCCGTCTGGGGATTCAAAAGGCTCAGGAAGCAATTGAGAACTCAGTCGGAACTCCTGCCAGTGTTAAACTCGAAAATAAAACAGACTTACAGTTTATAAGCCGACAAGAAGAGAGCAAGAAGGCTAAACAAAAGGCTCAGGTCAAGGTGCAGAAGAAGGATTCAAAGCAGCAGAAGAAAGTAGATCCTGAAAGGAGCCAGAAGACCGTGCGCCAGCTCCTCGGAGAACTGTACAGTGATAAGGAATATCTGGAATCATTATTAAGGGATGAAGCTCTAGTGAAAGGCAATACACGAGGTGGGGTCAAACTGCACGACCTGATCATTAATGGAATCCTGTACCTGGACACGCGCTCTGAGTTCTGGAGGCAGCAGAAGCCCATCTATGCGCGCCAGCGGGGACGGCAAGATCATGCAACAAAAAGTGGAAAGCGGGGATAAGGACC
Full Trace Sequence: CGGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGGAGACGGACGAGCAACAGGCGCCCCAAAGCACATTCAGCACTTACATGGCAGAGGGGGAGCAGCTGTATCACAAGGCGGAGTACAAGAAGGCCTCAGACAGTTTCACTGCGGCACTTCAGCTCCAACCTGAAGAGAAGAACTGCCTCGTTGCTCGTTCCAAGTGTTTCCTAAAACTCGGGGAGCCAGAATGTGCCCTGAAGGATGCAGAGGCCTCTCTACAGATCGAAAACGATTTCTTCAAGGGTCTTTACCAGAAGGCAGAGGCGCTCTACGCCATGGGAGACTTTGAGTTTGCCCTTGTGCATTACCACAGAGGGTACAAGCTGCGACCAGAATTTCAGGGATTCCGTCTGGGGATTCAAAAGGCTCAGGAAGCAATTGAGAACTCAGTCGGAACTCCTGCCAGTGTTAAACTCGAAAATAAAACAGACTTACAGTTTATAAGCCGACAAGAAGAGAGCAAGAAGGCTAAACAAAAGGCTCAGGTCAAGGTGCAGAAGAAGGATTCAAAGCAGCAGAAGAAAGTAGATCCTGAAAGGAGCCAGAAGACCGTGCGCCAGCTCCTCGGAGAACTGTACAGTGATAAGGAATATCTGGAATCATTATTAAGGGATGAAGCTCTAGTGAAAGGCAATACACGAGGTGGGGTCAAACTGCACGACCTGATCATTAATGGAATCCTGTACCTGGACACGCGCTCTGAGTTCTGGAGGCAGCAGAAGCCCATCTATGCGCGCCAGCGGGGACGGCAAGATCATGCAACAAAAAGTGGAAAGCGGGGATAAGGACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGGAGACGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ833731
dbEST ID: 79651433
Trimmed Sequence: GCCTTCATCCTCTTCTGTTCTTTGTACATGCACGTCCTCCTCCTCCTCATCCCTCGCTGTGTTCCCATCTGCCCTTAAATTGTCATTTTCATCATTGTTCTGTTCTGATTCCTGCTGCTCTTCCATCCCCTGCTTTGCATCCTCCAAGGCAACGAGGATGGCTTGCTCTGCATCCTTATTGTGAAGCAGTCGTGCTCTCTCCAACGCATTCTCAAAACTGCTAATGGCAGACTGGTAATGCTTCAGCTTCACTTCTGCTTGAGCTAATAACACACAGGCATTGAGCTGCCACTCAATATCTTCAGCTGCATCAGCCTCCTGCTGCGACTTTTCCCCATATTCCTTAGCTTCAGCAGTTTGCTCCAGCTCCAGGTAACATCTCCCAATCTCATGATACAACCAGGTCTTTTCTAAGCTTGAATTGGCCAGAGGGATCTTCTCTTCCCATACCTTGATGGCTTCATTGAATTTCCCAATGCGTGCATATACTCTCCCGATATTATCTAACGCTCGGGATTTCGCCTCCAGCAATTTGTATTTCTCTGCTATAGCCAAGTCCTTCTTGTGGCTCTGCAGTGCTGCCTCTATCTGACCCATGTCCATCTGAGCATTCCCAATGCAGCTGTGGAGACTCCAGTTAGCTCTTCCCTGTTGTGGAAATCTACGGATGTCCATCGGTTCNCTTTTCTTAACAAAAGTTGGGGCCTTTTTTGGAACTTTCCTCGGCTTTTTCCCTTTAAAAAGCAACTGGTCTATATTCCCCCCAACCTCCTTTAAAAATGTTT
Full Trace Sequence: CGGGCAAAATNGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCCTTCATCCTCTTCTGTTCTTTGTACATGCACGTCCTCCTCCTCCTCATCCCTCGCTGTGTTCCCATCTGCCCTTAAATTGTCATTTTCATCATTGTTCTGTTCTGATTCCTGCTGCTCTTCCATCCCCTGCTTTGCATCCTCCAAGGCAACGAGGATGGCTTGCTCTGCATCCTTATTGTGAAGCAGTCGTGCTCTCTCCAACGCATTCTCAAAACTGCTAATGGCAGACTGGTAATGCTTCAGCTTCACTTCTGCTTGAGCTAATAACACACAGGCATTGAGCTGCCACTCAATATCTTCAGCTGCATCAGCCTCCTGCTGCGACTTTTCCCCATATTCCTTAGCTTCAGCAGTTTGCTCCAGCTCCAGGTAACATCTCCCAATCTCATGATACAACCAGGTCTTTTCTAAGCTTGAATTGGCCAGAGGGATCTTCTCTTCCCATACCTTGATGGCTTCATTGAATTTCCCAATGCGTGCATATACTCTCCCGATATTATCTAACGCTCGGGATTTCGCCTCCAGCAATTTGTATTTCTCTGCTATAGCCAAGTCCTTCTTGTGGCTCTGCAGTGCTGCCTCTATCTGACCCATGTCCATCTGAGCATTCCCAATGCAGCTGTGGAGACTCCAGTTAGCTCTTCCCTGTTGTGGAAATCTACGGATGTCCATCGGTTCNCTTTTCTTAACAAAAGTTGGGGCCTTTTTTGGAACTTTCCTCGGCTTTTTCCCTTTAAAAAGCAACTGGTCTATATTCCCCCCAACCTCCTTTAAAAATGTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCTTCATCCTCTTCTGT