ORFeome > ttc38 ORF1 – XORFeome v1.0

ttc38 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ttc38
Gene ID: 5833300
Gene Page ID: 5833262
ORF Xenbase ID: 17302791

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129593
Original XGC clone length: 1410

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: A04

Sequences - 5ʹ (forward) EST

Accession: JZ838712
dbEST ID: 79656414
Trimmed Sequence: ATGGCGCCGCTGTCCCTGAGAGACTGCAAGGCTTGGCAAGACGCAGGCTTAACCCTTTCCACCACCAGCAACGAGGTTTGCAAACTTTTCGACGCCACCTTGATTCAGTATGCTACATGGAAAAACGACAGTACCCTGGGGGGAATCGAAGGTTGCCTGTCTCGCATTAACAATACCGATCCAAATTTCGTAATGGGCCACGTGGCTGCCAATGGTTTGGAACTGATCGGAACCGGGCGCTCTCCGCTGGTGGACAAGGAGCTGGACGATGCACTGAAGACAATGTCGGACCTTTCCAAGTCCCAGGCGCTGACTGAGAGAGAGAAGCTTCATGTAGCTGCCGTGGAAACGTTTGCCGATGGAAATCTCCCCAAAGCGGCTGATTTGTGGGAACGGATCTTGCAGAGCCACCCGACGGACCTTCTCGCTCTGAAATTCGCCCACGACTGTTATTTCTACCTTGGAGAGCAAAGGCAGATGAGAGATTCTGTGGCCAGAGTGCTGCCATACTGGAAACCCGAGACTCCACTGAACAGTTATGTCAAGGGCATGTACTCCTTTTAGGCTGCTTGAAACTAACTTTTATGAACCAGGCTCTGAAAGTGGGCAAAGAAGCTCTGAGCCTTAGAAAAGAGCGAATCCTGGGTCTTGGCGTACCATTTGCCCCGTTGCACCAAAAGAAAGCCGAAATTGAACGTCGGGGTGTGTCTTTTAATCCAAAAAAACCGAAAAGAAACTTGAAAGGAGGAACCGAGAGGGGCTGTGCCCTGCGCCCGTA
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCCGCTGTCCCTGAGAGACTGCAAGGCTTGGCAAGACGCAGGCTTAACCCTTTCCACCACCAGCAACGAGGTTTGCAAACTTTTCGACGCCACCTTGATTCAGTATGCTACATGGAAAAACGACAGTACCCTGGGGGGAATCGAAGGTTGCCTGTCTCGCATTAACAATACCGATCCAAATTTCGTAATGGGCCACGTGGCTGCCAATGGTTTGGAACTGATCGGAACCGGGCGCTCTCCGCTGGTGGACAAGGAGCTGGACGATGCACTGAAGACAATGTCGGACCTTTCCAAGTCCCAGGCGCTGACTGAGAGAGAGAAGCTTCATGTAGCTGCCGTGGAAACGTTTGCCGATGGAAATCTCCCCAAAGCGGCTGATTTGTGGGAACGGATCTTGCAGAGCCACCCGACGGACCTTCTCGCTCTGAAATTCGCCCACGACTGTTATTTCTACCTTGGAGAGCAAAGGCAGATGAGAGATTCTGTGGCCAGAGTGCTGCCATACTGGAAACCCGAGACTCCACTGAACAGTTATGTCAAGGGCATGTACTCCTTTTAGGCTGCTTGAAACTAACTTTTATGAACCAGGCTCTGAAAGTGGGCAAAGAAGCTCTGAGCCTTAGAAAAGAGCGAATCCTGGGTCTTGGCGTACCATTTGCCCCGTTGCACCAAAAGAAAGCCGAAATTGAACGTCGGGGTGTGTCTTTTAATCCAAAAAAACCGAAAAGAAACTTGAAAGGAGGAACCGAGAGGGGCTGTGCCCTGCGCCCGTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCCGCTGTCCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838711
dbEST ID: 79656413
Trimmed Sequence: TCCAAGGAGGCCGTGAAGTGCCTCCCACTTCTTTATGAATCCCCGAGTCAGAGGAGAGTTGGGCCTTCCGATGTCTCTCTCCATTAGCAGGACCCTGGCTAGATTTTGATGGTGTGTGGAATCGCTGTTTATGGCTGCCTGGATCAGAACCTGGTTAAACAGATCTCTCTGAGCGTCACTTCCTCCTATTTTCAATATCTGATACCGGATTGGATAGATCAAGTCCACAGCTTTGTCATAGTTTCCCCCGTTATACTCTATGAGAGCCTGGCACAGCGGGGCACCAAGGTGCTTAATCAAACTGTGTTGCTGCTTCTCACCGGGAGATTTGGACAGCTCCTGCATTGATTCCACAAGCTGACCGGTCGTATCCTCCTCCTTTGATCCCAATGACGACATTAGGAGATGGAGGTCGTTGAGAATTAGCATGTGATCTGTAATGTGTTTTCTTTTGATGGGCACCAGATTCTTCCACCGCTCTCCCACATTCACACCTTTCATCTGCAATCGGTACGGCATAGAGTGAGGTATCTACAGGATCAACCATCCCTGCACTGCCGGGTGACGTAAAAGGCAAGAGAATTAGCGTACAATGTGAGGGCAGGTGCGGACTCACCTTTCGCAATCAGATAAAAGAGAGGGGGAGCGGGTGGCGGGGGTGGTGGGGGGTGGCCGGTCCGGGCCGTTTTTTTAGCGGGTGGGTGGTTGGGGGGGGGGGCGGAAAGACCAAACTCAAACATGACCCCTCTTGCCCCGGTTTGCCCCAGGGGG
Full Trace Sequence: GAAAAGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCCAAGGAGGCCGTGAAGTGCCTCCCACTTCTTTATGAATCCCCGAGTCAGAGGAGAGTTGGGCCTTCCGATGTCTCTCTCCATTAGCAGGACCCTGGCTAGATTTTGATGGTGTGTGGAATCGCTGTTTATGGCTGCCTGGATCAGAACCTGGTTAAACAGATCTCTCTGAGCGTCACTTCCTCCTATTTTCAATATCTGATACCGGATTGGATAGATCAAGTCCACAGCTTTGTCATAGTTTCCCCCGTTATACTCTATGAGAGCCTGGCACAGCGGGGCACCAAGGTGCTTAATCAAACTGTGTTGCTGCTTCTCACCGGGAGATTTGGACAGCTCCTGCATTGATTCCACAAGCTGACCGGTCGTATCCTCCTCCTTTGATCCCAATGACGACATTAGGAGATGGAGGTCGTTGAGAATTAGCATGTGATCTGTAATGTGTTTTCTTTTGATGGGCACCAGATTCTTCCACCGCTCTCCCACATTCACACCTTTCATCTGCAATCGGTACGGCATAGAGTGAGGTATCTACAGGATCAACCATCCCTGCACTGCCGGGTGACGTAAAAGGCAAGAGAATTAGCGTACAATGTGAGGGCAGGTGCGGACTCACCTTTCGCAATCAGATAAAAGAGAGGGGGAGCGGGTGGCGGGGGTGGTGGGGGGTGGCCGGTCCGGGCCGTTTTTTTAGCGGGTGGGTGGTTGGGGGGGGGGGCGGAAAGACCAAACTCAAACATGACCCCTCTTGCCCCGGTTTGCCCCAGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCAAGGAGGCCGTGAA