ORFeome > ttc5 ORF1 – XORFeome v1.0

ttc5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ttc5
Gene ID: 1001737
Gene Page ID: 1001729
ORF Xenbase ID: 17302803

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126001
Original XGC clone length: 1296

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ837592
dbEST ID: 79655294
Trimmed Sequence: ATGGCAGAGGAGGGTGTGGACACAGAAGCAGAAATCCAGAAGAGTTTGCAGGAGCTTGTTGACAGTCTTTATGCATTCCGGGACCCCTTATTTTGAGACGCACAGTGTGGAAGATGCTGCTAGGAAGCAATATGATGTTGAAAAGGAAATGGAGAAAACCATTGCACAGATGAACGAGATTGATGATACCTGGAAGAGCAAAGCTTTCTTTTTAATGCTTCGAGGAAAGGCCTTAAATGTCACTCCGAATTATAGCCAAGAGGCAGAGGATGCGCTTTCTAAGGCAGTAAAATTGGATCCCGGACTTGTAGAAGGATGGAATCAGCTGGGAGAGGTGTATTGGAAGAAAATGGATGTGGCGGCTGCTAAAACATGTTTCTTGGGAGCACTGAATCACTGCAGAAATAAAGTCTCTCTTCGTAACTTGTCCATGGTTATGCAACAGCAGCGATCACAGGATGCGGAGGAGAATAATATAAACATTATGTACAGTGTGAGAGAGACCAAGGAGGCTGTACGGATAGACCCATGTGATGGGAGTTCCTGCTACGTACTTCCATGTGCGTACCTCTCCCTGTTCGTCTGTCCTGGGCGGAATGCCTAAATCTCTCCCCTATCTGGGATTGGCATGTGTTGGGGCGGGAAGGAGTTGAATAGAGTGGATGGGGCAGGGCCCTAATCTGGGTCGCGGGCCGACCAAACACCTCTTTTATTTTTTGGGAAAAAAAAAAAAAGATAACCGTGGAAGGCGGAGTGTTATTTAACGGTCTTTCGCCTGGCCCCGTTCAACCAGGAGAGGAC
Full Trace Sequence: GCGGGCCCATATAATGGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGAGGAGGGTGTGGACACAGAAGCAGAAATCCAGAAGAGTTTGCAGGAGCTTGTTGACAGTCTTTATGCATTCCGGGACCCCTTATTTTGAGACGCACAGTGTGGAAGATGCTGCTAGGAAGCAATATGATGTTGAAAAGGAAATGGAGAAAACCATTGCACAGATGAACGAGATTGATGATACCTGGAAGAGCAAAGCTTTCTTTTTAATGCTTCGAGGAAAGGCCTTAAATGTCACTCCGAATTATAGCCAAGAGGCAGAGGATGCGCTTTCTAAGGCAGTAAAATTGGATCCCGGACTTGTAGAAGGATGGAATCAGCTGGGAGAGGTGTATTGGAAGAAAATGGATGTGGCGGCTGCTAAAACATGTTTCTTGGGAGCACTGAATCACTGCAGAAATAAAGTCTCTCTTCGTAACTTGTCCATGGTTATGCAACAGCAGCGATCACAGGATGCGGAGGAGAATAATATAAACATTATGTACAGTGTGAGAGAGACCAAGGAGGCTGTACGGATAGACCCATGTGATGGGAGTTCCTGCTACGTACTTCCATGTGCGTACCTCTCCCTGTTCGTCTGTCCTGGGCGGAATGCCTAAATCTCTCCCCTATCTGGGATTGGCATGTGTTGGGGCGGGAAGGAGTTGAATAGAGTGGATGGGGCAGGGCCCTAATCTGGGTCGCGGGCCGACCAAACACCTCTTTTATTTTTTGGGAAAAAAAAAAAAAGATAACCGTGGAAGGCGGAGTGTTATTTAACGGTCTTTCGCCTGGCCCCGTTCAACCAGGAGAGGAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGAGGAGGGTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837591
dbEST ID: 79655293
Trimmed Sequence: CTCACTCTGAGGCCTGTAAGCCACTATTGCACCTGCCTGTGTGCTAGGTCCCTGTGGCTTGCCATTGACTAGTAACTGGACAGGGGAGTCAACACGTATACTTTGGAATGTAAACATCTGGCCTTTATGCTTTATATTATGCTGCTTCAAGAGAGGATCAGGAATGCTCACAGAATCTGCAATGAGGACACCCCAGCTCTCTACCATGTTATAAACCATTACTGCATAACAGGTGCCCTCTGCATCTACCAGACCGAAAGTGAATGGCACTCGTTCCTCGGTCATAACGCTGAATACAACTTTTCCCAACACTACACAGCCTGGGTTCCTGCCTGGTTGCAAAGAACTCAGTGGTTTAAACTCTAATCCTCCAGAGACACCAAAATGACCAAGAAGAGAAGGACTTAGGCTATTGAGCATATTCTGCAGCCTTTTCCCTCGTATCTTGCCCTTGTTGGCTAGAAGGCCACACAGTTTGCCCAGGTAATCAAGCAGTTGCTGTTCTCTCATGACTGGTTCAGTCCATGAAGGTTCTAGAGAAACAGCTGGTGAAAAACCCTCTAATGCACCATCAAATCTCTCTTCATACTTACACAATGGTGGCTCGGTTGAAATGGAAATCTGAATTGCCTGAATGCGGTCCTGTCCAATTCTTTCCGCCCCGCCCATTACGCATTCCAAAACCTCCTGAGAAAATTTTAGGAATTTCTTTTCCAGGGGCAAAAAAAAAAAATTAAAAAAAGAAAAACAATTTTCCGAAGGGGATATTAAACCGAAGA
Full Trace Sequence: GGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCACTCTGAGGCCTGTAAGCCACTATTGCACCTGCCTGTGTGCTAGGTCCCTGTGGCTTGCCATTGACTAGTAACTGGACAGGGGAGTCAACACGTATACTTTGGAATGTAAACATCTGGCCTTTATGCTTTATATTATGCTGCTTCAAGAGAGGATCAGGAATGCTCACAGAATCTGCAATGAGGACACCCCAGCTCTCTACCATGTTATAAACCATTACTGCATAACAGGTGCCCTCTGCATCTACCAGACCGAAAGTGAATGGCACTCGTTCCTCGGTCATAACGCTGAATACAACTTTTCCCAACACTACACAGCCTGGGTTCCTGCCTGGTTGCAAAGAACTCAGTGGTTTAAACTCTAATCCTCCAGAGACACCAAAATGACCAAGAAGAGAAGGACTTAGGCTATTGAGCATATTCTGCAGCCTTTTCCCTCGTATCTTGCCCTTGTTGGCTAGAAGGCCACACAGTTTGCCCAGGTAATCAAGCAGTTGCTGTTCTCTCATGACTGGTTCAGTCCATGAAGGTTCTAGAGAAACAGCTGGTGAAAAACCCTCTAATGCACCATCAAATCTCTCTTCATACTTACACAATGGTGGCTCGGTTGAAATGGAAATCTGAATTGCCTGAATGCGGTCCTGTCCAATTCTTTCCGCCCCGCCCATTACGCATTCCAAAACCTCCTGAGAAAATTTTAGGAATTTCTTTTCCAGGGGCAAAAAAAAAAAATTAAAAAAAGAAAAACAATTTTCCGAAGGGGATATTAAACCGAAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCACTCTGAGGCCTGTAA