ORFeome > tuba1a ORF1 – XORFeome v1.0

tuba1a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tuba1a
Gene ID: 5834879
Gene Page ID: 5834443
ORF Xenbase ID: 17302851

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC070609
Original XGC clone length: 1353

Human orthology & disease relationships

NCBI Entrez ID: 7846
Ensembl gene IDs: ENSG00000167552
Directly associated (OMIM) disease MIM numbers: 611603
Indirectly associated (Lage, et al.) disease MIM numbers: 104300,115150,124900,125800,125853,148700,161800,162210,164400,191100,193520,214450,253300,253400,253550,256710,301000,303600,313900,600334,600652,603278,603622,603689,604145,605249,605407,606690,607785,608751,608807,608808,609227

Library Location

Plate ID: GDExl11027
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ825406
dbEST ID: 79643108
Trimmed Sequence: ATGAGAGAATGCATATCTGTCCACATTGGCCAAGCAGGAGTTCAGATGGGCAATGCCTGCTGGGAACTCTATTGCCTAGAGCATGGACTTCAGCCAGATGGAACAATGCCTAGTGAAAAGACTGCAACAATGGTGGATTCCTCCTTTGGGACATTCTTCAGTGAAACTGGGTCTGGAAAGCATGTGCCCAGAGCTGTCTTTGTTGACTTGGAGCAAACTGTTATTGGTGAGGTCAGAACTGGAGCCTATCGATCGTTATTCCATCCAGAACAACTCATTACAGGGAAGGAAGATGCAGCCAATAATTATGCACGGGGTCACTATACAATTGGGAAAGAATTAATAGATTCTGTGCTTGATCGCATAAGAAAAATGGCTGACCAGTGTTCTGGCCTCCAAGGATTTCTTGTCTTTCACAGTTTTGGTGGAGGTACAGGCTCTGGCTTTACTTCATTATTAATGGAACGCCTTTCTGTTGATTATGGAAAGAAATCAAAGCTTGAATTCTCAGTCTATCCTGCCCCTAGAATATCCACTGCAGTGGTAGAACCTTACAATTCCATCCTGACAACCCATACAACTCTGGAACATTCAAACTGTGCCTTCATGGTGGACAATGAAGCGATTTATGATATTTTGCACCCGTAACTTGGATATTGAACGTCCTTCTTATACTAATTTAAACAGAATTAATACCTCAAAAAATTTCTTTCCATAAACGCCCTCCTTTGAGGTTTTGAATGGCGCCACTTAAATGTTTGAATCTTCCCA
Full Trace Sequence: GGTTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGAGAATGCATATCTGTCCACATTGGCCAAGCAGGAGTTCAGATGGGCAATGCCTGCTGGGAACTCTATTGCCTAGAGCATGGACTTCAGCCAGATGGAACAATGCCTAGTGAAAAGACTGCAACAATGGTGGATTCCTCCTTTGGGACATTCTTCAGTGAAACTGGGTCTGGAAAGCATGTGCCCAGAGCTGTCTTTGTTGACTTGGAGCAAACTGTTATTGGTGAGGTCAGAACTGGAGCCTATCGATCGTTATTCCATCCAGAACAACTCATTACAGGGAAGGAAGATGCAGCCAATAATTATGCACGGGGTCACTATACAATTGGGAAAGAATTAATAGATTCTGTGCTTGATCGCATAAGAAAAATGGCTGACCAGTGTTCTGGCCTCCAAGGATTTCTTGTCTTTCACAGTTTTGGTGGAGGTACAGGCTCTGGCTTTACTTCATTATTAATGGAACGCCTTTCTGTTGATTATGGAAAGAAATCAAAGCTTGAATTCTCAGTCTATCCTGCCCCTAGAATATCCACTGCAGTGGTAGAACCTTACAATTCCATCCTGACAACCCATACAACTCTGGAACATTCAAACTGTGCCTTCATGGTGGACAATGAAGCGATTTATGATATTTTGCACCCGTAACTTGGATATTGAACGTCCTTCTTATACTAATTTAAACAGAATTAATACCTCAAAAAATTTCTTTCCATAAACGCCCTCCTTTGAGGTTTTGAATGGCGCCACTTAAATGTTTGAATCTTCCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGAGAATGCATATCTGTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ825405
dbEST ID: 79643107
Trimmed Sequence: GTATTCATCCTCCTCGTCCTCTCCAGCTTCAACAGACTCTGTTCCCAACTTCTTCATAATCCTTTTCTAGGGCAGCCATATCCTCTCTAGCCTCAGAGAACTCCCCTTCTTCCATACCTTCTCCAACATACCAGTGCACAAAGGCCCTCTTAGAATACATCAGGTCAAACTTGTGGTCTAACCTGGCCCAAGCCTCAGCAATAGCAGTGGTGTTACTCAGCATACACACAGCTCGTTGCACTTTTGCCAAGTCCCCTCCTGGCACAACTGTAGGGGGCTGGTAGTTAATTCCTACCTTAAAGCCAGTTGGACACCAGTCAACAAACTGAATTGTCCTTCTGGTTTTGATTGCAGCAATTGCTGCATTGACATCTTTGGGCACTACATCACCTCTGTACAGCAGACAGCAAGCCATATATTTACCACGGCGAGGGTCACATTTCACCATCTGGTTGGAATATTCAAAACATGCATTGGTTATTTCTGGGACAGATAGCTGCTCATGATAGGCTTTCTCTGCTGAAATAATGGGTGAATAGGTGACCAATGGGAAAGTGGATTCTAGGAATAAGCACCAATTTTGTTTGGAACTCTGTGAGATCCACATTTAGTGCGCCATCAAACCTCCATGAAGCCCTTAATGGAAAAAACTATTTAATCTATTAATCCGTTTAAATTAATAAAAAAAAAAGGAATTTCAAAAAACCCCAATTTTACCGGTTTTCCAAAAAAACAAAAAAAACCCCTTCCCATTTCCCCCCCA
Full Trace Sequence: GGTGGCCGGGAGCGCTAGGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTATTCATCCTCCTCGTCCTCTCCAGCTTCAACAGACTCTGTTCCCAACTTCTTCATAATCCTTTTCTAGGGCAGCCATATCCTCTCTAGCCTCAGAGAACTCCCCTTCTTCCATACCTTCTCCAACATACCAGTGCACAAAGGCCCTCTTAGAATACATCAGGTCAAACTTGTGGTCTAACCTGGCCCAAGCCTCAGCAATAGCAGTGGTGTTACTCAGCATACACACAGCTCGTTGCACTTTTGCCAAGTCCCCTCCTGGCACAACTGTAGGGGGCTGGTAGTTAATTCCTACCTTAAAGCCAGTTGGACACCAGTCAACAAACTGAATTGTCCTTCTGGTTTTGATTGCAGCAATTGCTGCATTGACATCTTTGGGCACTACATCACCTCTGTACAGCAGACAGCAAGCCATATATTTACCACGGCGAGGGTCACATTTCACCATCTGGTTGGAATATTCAAAACATGCATTGGTTATTTCTGGGACAGATAGCTGCTCATGATAGGCTTTCTCTGCTGAAATAATGGGTGAATAGGTGACCAATGGGAAAGTGGATTCTAGGAATAAGCACCAATTTTGTTTGGAACTCTGTGAGATCCACATTTAGTGCGCCATCAAACCTCCATGAAGCCCTTAATGGAAAAAACTATTTAATCTATTAATCCGTTTAAATTAATAAAAAAAAAAGGAATTTCAAAAAACCCCAATTTTACCGGTTTTCCAAAAAAACAAAAAAAACCCCTTCCCATTTCCCCCCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTATTCATCCTCCTCGTCCT