ORFeome > tuba4a ORF1 – XORFeome v1.0

tuba4a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tuba4a
Gene ID: 490059
Gene Page ID: 490054
ORF Xenbase ID: 17302875

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129696
Original XGC clone length: 1371

Human orthology & disease relationships

NCBI Entrez ID: 7277
Ensembl gene IDs: ENSG00000127824
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 215600,268000,600652,603278,610015

Library Location

Plate ID: GDExl11091
Well Location: A05

Sequences - 5ʹ (forward) EST

Accession: JZ838639
dbEST ID: 79656341
Trimmed Sequence: ATGTGGGGGATCAGAAGCAAATCAAGGGAGTGCATTTCTGTGCACATTGGCCAAGCCGGCCTTCAGATTGGCAATGCATGCTGGGAACTCTTCTGCTTGGAGCATGGCATCCAACCGGATGGCACCTTTTTGGACCAACAGAAAACGGGCAGCTCTGCCGACTCCTTTGAAACGTTCTTCAGCGAGAGCAGCAATGGGAAGCACGTGCCACGGGTCATTTTGGTGGATTTGGAGACCACGGTAGCGGATGAGATCCGGGGAGGAATTTACCGACACCTGTTTCACCCAGAACACTTTATTACGGGTAAAGAGGACGCAGCAAATAATTACGCCCGAGGACACTACACTGTTGGGAAAGAAATCATTGACCTGGTGCTGGATCGGATACGGAAGCTGACTGACGCCTGTTCCAGCCTGCAGGGTTTCCTGGTTTTCCACAGCTTCTGAGGAGGAACCGGTTCTGGGTTCACCTCTCTTCTCATGGAGCGACTGTCCCTGGATTATGGGAAGAAATCCAAGCTGGAGTTTGCTATAATATCCGCACCGCGGAACTCCACGGGAAGTGGGGGACGCTAACACTCATTCCTGAAAACGCAAACTACTCATGGAACTTCAAACTGTGCCGTTCTGGTAAAAAATAAAGCCCTTTTATAACCTTTGCCATCGAAAACCTGGAAATGTGGGCAGCAAGCGAATAAGGGAAGTAAACAGGGCCTAATTAGCCCAAAACCGCCCCCTCCCCTCG
Full Trace Sequence: TCGGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGGGGATCAGAAGCAAATCAAGGGAGTGCATTTCTGTGCACATTGGCCAAGCCGGCCTTCAGATTGGCAATGCATGCTGGGAACTCTTCTGCTTGGAGCATGGCATCCAACCGGATGGCACCTTTTTGGACCAACAGAAAACGGGCAGCTCTGCCGACTCCTTTGAAACGTTCTTCAGCGAGAGCAGCAATGGGAAGCACGTGCCACGGGTCATTTTGGTGGATTTGGAGACCACGGTAGCGGATGAGATCCGGGGAGGAATTTACCGACACCTGTTTCACCCAGAACACTTTATTACGGGTAAAGAGGACGCAGCAAATAATTACGCCCGAGGACACTACACTGTTGGGAAAGAAATCATTGACCTGGTGCTGGATCGGATACGGAAGCTGACTGACGCCTGTTCCAGCCTGCAGGGTTTCCTGGTTTTCCACAGCTTCTGAGGAGGAACCGGTTCTGGGTTCACCTCTCTTCTCATGGAGCGACTGTCCCTGGATTATGGGAAGAAATCCAAGCTGGAGTTTGCTATAATATCCGCACCGCGGAACTCCACGGGAAGTGGGGGACGCTAACACTCATTCCTGAAAACGCAAACTACTCATGGAACTTCAAACTGTGCCGTTCTGGTAAAAAATAAAGCCCTTTTATAACCTTTGCCATCGAAAACCTGGAAATGTGGGCAGCAAGCGAATAAGGGAAGTAAACAGGGCCTAATTAGCCCAAAACCGCCCCCTCCCCTCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGGGGATCAGAAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838638
dbEST ID: 79656340
Trimmed Sequence: ATATTCTTCTCCTTCATTCTCGTCCTCAATCGAGTCTATTCCCACCTCCTCGTAATCTTTCTCCAGGGCTGCTAAGTCCTCTCGAGCCTCTGAAAACTCGCCCTCCTCCATGCCCTCGCCAACGTACCAGTGTACAAAGGCACGCTTGGCGAACATCAAATCAAACTTGTGGTCTAGCCGTGCCCAGGCCTCAGCGATGGCCGTGGTGTTACTGAGCATGCAGACTGCACGCTGAACCTTGGCAAGGTCTCCTCCTGGCACCACGGTGGGAGGCTGGTAATTAATGCCCACCTTGAATCCAGTGGGACACCAATCTACAAACTGTATGTTTTTCTTAGTCTTTATAGAGGCAATGGCCACGTTGACATCTTTGGGCACCACATCACCACGATAAAGCAAACAGCAGGCCATGTACTTCCCGTGGCGGGGGTCACACTTCACCATCTGATTACACGGCTCAGAGCAAGCATTGGTGATATCTGCCACAGATAATTGCTCATGGGAAGCCTTGTTTGATGAGATGATAGGGGCATAGGTGACCAGAGGGAAATGAATGCGTGGGTAAGGCACCAAGTTGGTTTGGAACTCTGTCAGGTCTACGTTGAAGGCACCATCGAATCTCAGGGAGGCCGTTGATGGAGGAGACGATCCTGCTAATGAACCTGTTCAGTAACCATATAGGTTTGGCCCGCTCATGGTCCAGGTTTCAAATGCCCACAGTTCCAAAAATGGGCCTCCATTGGTCCACCCCATGAAGGGGCC
Full Trace Sequence: GGTAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATATTCTTCTCCTTCATTCTCGTCCTCAATCGAGTCTATTCCCACCTCCTCGTAATCTTTCTCCAGGGCTGCTAAGTCCTCTCGAGCCTCTGAAAACTCGCCCTCCTCCATGCCCTCGCCAACGTACCAGTGTACAAAGGCACGCTTGGCGAACATCAAATCAAACTTGTGGTCTAGCCGTGCCCAGGCCTCAGCGATGGCCGTGGTGTTACTGAGCATGCAGACTGCACGCTGAACCTTGGCAAGGTCTCCTCCTGGCACCACGGTGGGAGGCTGGTAATTAATGCCCACCTTGAATCCAGTGGGACACCAATCTACAAACTGTATGTTTTTCTTAGTCTTTATAGAGGCAATGGCCACGTTGACATCTTTGGGCACCACATCACCACGATAAAGCAAACAGCAGGCCATGTACTTCCCGTGGCGGGGGTCACACTTCACCATCTGATTACACGGCTCAGAGCAAGCATTGGTGATATCTGCCACAGATAATTGCTCATGGGAAGCCTTGTTTGATGAGATGATAGGGGCATAGGTGACCAGAGGGAAATGAATGCGTGGGTAAGGCACCAAGTTGGTTTGGAACTCTGTCAGGTCTACGTTGAAGGCACCATCGAATCTCAGGGAGGCCGTTGATGGAGGAGACGATCCTGCTAATGAACCTGTTCAGTAACCATATAGGTTTGGCCCGCTCATGGTCCAGGTTTCAAATGCCCACAGTTCCAAAAATGGGCCTCCATTGGTCCACCCCATGAAGGGGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATATTCTTCTCCTTCATTCTCGTC